Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19568

FASTA Sequence
Unigene ID: UN19568Length: 638  SNP
GGACTGTGGAAAAGAGTGACATCTAGAAGGAGAGAGTTGAATTCAATCGGAAGCAGGAGGAGGAATGAGCGGAGTTTCAACGGCGG
CGTATTTCGCGCGGCGAGCGGCGCAGAAGGAGAGGGTTCGAATCCTCTATCGACGCGCCCTTAAGGATACTCTCAATTGGGCTGTT
CATCGCCACATTTTCTACCGAGACGCTTCTGATCTGCGCGAGAAGTTCAACGCCAACCAAGATGTGGAGGATGTTGACAGAATCGA
CAAACTGATTGCTCATGGTGAAGCTGAGTACGACAAATGGCGGCACCCTGATCCTTATATCGTTCCATGGGCTCCTGGTGGCTCCA
AGTTCTGTAGAAACCCCACTCCACCTGCTGGGATTGAGATTGTGTACAACTATGGTCAAGAAGACAACCCATAAAACTTAATTTTC
CTGTGGCTATGGTTCAGAAAATAAATTTTTACTTTCAAAGATGTTTTGTTTTAGCGTGACCACTCTTGTTTCAGCATGGTTTACAT
TTGTTCATCTAAAACATGTCATCATGAATCATGGATGTCCCATGAAAACTTATTCAATAAACAACAAAAGTGTGTTCTGTCTTTAC
TTTGGCTACCATGGCTCATAAATTTTGTGATTTTCT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002869129 hypothetical protein ARALYDRAFT_912916 [Arabidopsis lyrata subsp. lyrata]6272e-063
NP_567970 NADH dehydrogenase (ubiquinone) 1 beta subcomplex 9 [Arabidopsis thaliana]6236e-063
XP_002512999 NADH dehydrogenase, putative [Ricinus communis]5367e-053
XP_002268405 PREDICTED: hypothetical protein [Vitis vinifera]5313e-052
ACU13557 unknown [Glycine max]5091e-049

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q8LDS9 Putative uncharacterized protein6271e-063
Q945M1 AT4g34700/T4L20_2806234e-063
B9RHE0 NADH dehydrogenase, putative5365e-053
C6SWD4 Putative uncharacterized protein5097e-050
C6T5D6 Putative uncharacterized protein5052e-049

Arabidopsis top hits (Blast detail)Scoree value
AT4G34700.1 complex 1 family protein / LVR family protein6242e-065

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
91  3%
 
113  10%
 
87  24%
 
105  17%
 
126  21%
 
62  7%
 
74  14%
 
181  3%

Unigene MembersMember information