Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19577

FASTA Sequence
Unigene ID: UN19577Length: 1261  SNP
GGGTGTACATAGATGAGTGAATATACAAATAACAGATTAAGAAGCTTGCCGGTATCGTAGCCAAAGAGAAGACCACCGATTCCAGC
GGAGAAAGCAAGACGAAGAACATAAGGGTTCTTCCATGTTAGAGAAAAACACTCTCTGAAAGCTGATTTATCTGCTCCTCCATAAG
CGACAAAATACTACCGTGACCAAAACTGAATGAAAACATTGGAAAAAATACATTTGAGTATCTTGAAAGGCCTCACCGAGAGGTAT
TAATTGGCAAAGGCCTCACTGAGAGGTATTAATTGGGCCAAATAATAAGTCCAATACAAGAAAACCTAGAGGCGTTATATAAATTC
CAGCATCCCTCGTCAGCCCTCAGGCCTCTTCTTCCTCTTCAAGTCCGCCGTTGCAACTCAGTGATAAAGGCTCGAGCTTTAGAAGA
CAATGGCTGCTTCTTTCCCCAACCTTAACTCTGATTCTGGATTGAAGAAGCTCGACGAGCATCTCCTCACTCGCAGTTACATCACT
GGGTACCAGGCTTCAAAGGATGACATCACTGTCTTTACAGCTCTTGCAAAGCCTCCAACTTCACAGTATGTCAACGCATATCGTTG
GTACAGCCACATCGATGCCCTTTTGAGGATCTCTGGTGTCTCTGCTGAAGGAAGCGGTGTCATTGTTGAGGGATCAGCCCCCGTCT
CAGAGGAGGCTGTTGCTACTCCACCAGCAGCTGATTCTAAGGATGCGGCTGATGAGGAAGATGATGATGATGTTGATCTTTTCGGT
GAGGAGACCGAAGAGGAGAAGAAAGCTGCTGAAGAGAGAGCTGCTTCCGTGAAGGCATCTACTAAGAAGAAGGAATCTGGAAAGTC
ATCAGTCTTGATTGATATCAAGCCATGGGATGATGAGACTGACATGAAGAAGCTAGAGGAAGCTGTGAGATCCGTCCAGATGGAAG
GATTATTCTGGGGAGCGTCAAAGCTTGTACCGGTTGGTTACGGTATCAAGAAGTTGCAGATCATGTGCACCATTGTTGACGACCTC
GTCTCTGTTGACACCATGATTGAAGAGACGCTCACCGTCGAGCCAATCAATGAGTTTGTCCAGAGCTGTGACATTGTTGCCTTCAA
CAAAATCTGAGGATGGAGAAAAGAGCTCAAGGATGTCCTTTGTGTGTTTTTATTTTTTGAGTTTCCTGTGTTTTCTACTGTTGTTT
TGATTCTGATATTTGAATAATTTTGATGCTTATTCAATACAGTCTTTTCTTTATTTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ABK78691 putative elongation factor 1-beta [Brassica rapa]11214e-120
XP_002890860 elongation factor 1-beta [Arabidopsis lyrata subsp. lyrata]11188e-120
NP_001077627 elongation factor 1-delta 1 [Arabidopsis thaliana]11142e-119
NP_174314 elongation factor 1-delta 1 [Arabidopsis thaliana]11017e-118
E86426 probable elongation factor 1-beta [imported] - Arabidopsis thaliana11017e-118

Swiss-Prot top hits (Blast detail)Scoree value
P48006 Elongation factor 1-delta 111013e-119
Q9SI20 Elongation factor 1-delta 210753e-116
P93447 Elongation factor 1-delta8854e-094
O81918 Elongation factor 1-delta8782e-093
Q40682 Elongation factor 1-delta 28576e-091

TrEMBL top hits (Blast detail)Scoree value
A0T2P4 Putative elongation factor 1-beta11212e-120
A8MRC4 Uncharacterized protein At1g30230.211142e-119
B3LF87 At1g3023011015e-118
Q39124 EEF-1beta protein10461e-111
C0LJH8 Seed ripening regulated protein9681e-102

Arabidopsis top hits (Blast detail)Scoree value
AT1G30230.2 elongation factor 1-beta / EF-1-beta11149e-122
AT1G30230.1 elongation factor 1-beta / EF-1-beta11022e-120
AT2G18110.1 elongation factor 1-beta, putative / EF-1-beta, putative10762e-117
AT5G19510.1 elongation factor 1B alpha-subunit 2 (eEF1Balpha2)6452e-067
AT5G12110.1 elongation factor 1B alpha-subunit 1 (eEF1Balpha1)6425e-067

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
124  21%
 
102  11%
 
114  21%
 
75  26%
 
181  5%
 
202  11%
 
191  5%

Unigene MembersMember information