Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19581

FASTA Sequence
Unigene ID: UN19581Length: 1760  SNP
TTCTACTTTCTCTCTCTCCTCTTTTCTTCTCAACACCCTCAAATCAAATAGAAAACCTCACAAAAAGAAAGACTTAAGAAGAAGAC
GACGGAAGTAGAAGGGAAGATCAAGAAAGAGGAAGATATCACCAACCAGGAAGATGGCCACAAATCATAACCATACTCATCATCTT
TCTTATTCACTTCTTCATGGCCTCAGCAGCAATCCTCCACCTCCTGGATTCATTAACCAAGATGGATCCTCCAGCTTCGACTTCGG
AGAGCTAGAAGAAGCAATTGTTCTGCAAGGTGTTAAGTATAGGAACAACGAAACTAAGCCACCTTTATTTGCAGGAGGAGCTACGA
CTCTGGAGATGTTCCCTTCATGGCCAATCAGAACTCACCAAACTCTTCCTACTGAGGAGAGTTCCAAGTCAGGAGGAGAGAGCACC
GATTCAGGATCAGCAAATTTCTCAGGCAAAGCAGAAAGTCAACAGCCCGAGTCTCCGATGAGTAGCAAACAGAATCATCATCTCAT
GCTTCAGCAGCATCAACGTAATAACAACATGGCAAACTCAGGCTCAACATCTGGACTTCCCTCTACTTCTCGAACTCCAGCTCCTC
CAAAAGCTTCTGAGGATAAGAGGAAGGCTACGACTTCAGGCAAACTTCTTGATGCTAAGACATTGAGACGTTTGGCCCAAAATAGA
GAAGCTGCTCGCAAAAGCCGTCTTAGGAAAAAGGCTTACGTGCAACAGCTAGAATCAAGTAGGATAAAACTTTCCCAGTTGGAGCA
AGAACTTCAGCGAGCTCGATCTCAGGGGATGTTTATGGGTGGCTGTGGTCCACCTGGACCTAACATCACTTCCGGAGCTGCAATGT
TTGACATGGAATATGGGAGGTGGCTAGAGGAAGATAACCGGCACATGTCGGAGATTCGTACCGGTCTTCAGGCTCATTTATCTGAC
AATGATTTAAGGTTGATCGTTGACGGTTACATCGCTCACTTTGATGAGGTGTTACGTTTAAAAGCTGTGGCCGCGAAAGCAGACGT
TTTCCACCTCATCATCGGTACATGGATGTCCCCTGCCGAACGCTGTTTTATCTGGATGGCCGGATTCCGTCCATCTGACCTCATCA
AGATACTTGTGTCGCAAATGGATCTATTGACGGAGCAACAACTGATGGGGATATATAGCCTACAACACTCATCGCAACAAGCGGAG
GAGGCTCTCTCGCAAGGACTCGAACAACTTCAGCAATCTCTCATCGATACTCTAGCTGCCTCTCCCGTCATGGACGGTATGCAACA
AATGGCTGTCGCTCTCGGCAAAATCTCTAATCTCGAAGGCTTTATCCGCCAGGCTGATAACCTGAGGCAGCAAACTGTTCACCAGC
TGCGTCGGATTTTGACCGTTCGCCAAGCCGCACGTTGTTTCCTAGTCATCGGGGAGTATTACGGAAGGCTCAGAGCTCTTAGCTCT
CTTTGGTTGTCTCGACCACGAGAGACGCTGATAAGTGATGAGACATCTTGCCAAACGACGACGGAGTTGCAGATGGTTCAATCATC
GCGGAACAACTTCTCCAATTTCTGAATCGAAATGGAAACCTTGTATGACTAAATGGGCCAAGTTCCTTTGTCTTAAGCTCACTCTT
CTGCTACTCTGTTTCCTTTATGTTGTACTACTAGCAATGTTAGGATCTTCTTTCAGACTATAGTTTTATGCTATGAAATTAACGTA
CCATGTAAATCGAACCAACTTATGTGCCAAGTAAAATGAG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_563810 bZIP transcription factor-like protein [Arabidopsis thaliana]22273e-248
BAE99654 bZip protein AtbZip21 [Arabidopsis thaliana]22212e-247
NP_001030998 bZIP transcription factor-like protein [Arabidopsis thaliana]17051e-187
XP_002313591 predicted protein [Populus trichocarpa]16871e-185
AAF18246 T23G18.19 [Arabidopsis thaliana]16808e-185

Swiss-Prot top hits (Blast detail)Scoree value
Q39234 Transcription factor TGA37735e-081
Q93ZE2 Transcription factor TGA77556e-079
Q39237 Transcription factor TGA17422e-077
P14232 TGACG-sequence-specific DNA-binding protein TGA-1A7378e-077
Q39162 Transcription factor TGA47332e-076

TrEMBL top hits (Blast detail)Scoree value
Q93XM6 BZIP transcription factor22272e-248
Q0WT94 BZip protein AtbZip2122211e-247
Q56W43 BZip protein AtbZip2117057e-188
B9HQ02 Predicted protein16879e-186
Q9SGC7 T23G18.1916806e-185

Arabidopsis top hits (Blast detail)Scoree value
AT1G08320.1 bZIP family transcription factor22289e-251
AT1G08320.3 bZIP family transcription factor22289e-251
AT1G08320.2 bZIP family transcription factor17063e-190
AT1G22070.1 TGA3; DNA binding / calmodulin binding / protein binding / transcription factor7735e-082
AT1G77920.1 bZIP family transcription factor7556e-080

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
201  7%
 
83  21%
 
122  14%
 
93  21%
 
102  14%
 
113  21%

Unigene MembersMember information