Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19646

FASTA Sequence
Unigene ID: UN19646Length: 748  SNP
GGAGGGTTAGGGTTTTCACAGCCGCTTTAAAAAACATATCACCTCTTTGCTTTTGCTGTTGATCATCATCACCTCCATCTAGAAAC
ATGGGTAAGACAAGGGGTATGGGAGCAGGGCGCAAGCTCAAAAGACTCCGGATCAATCAGAGGTGGGCTGACAAGCAGTACAAGAA
GTCACATCAGGGGAATGAATGGAAGAAGCCTTTCGCTGGTTCTTCCCACGCCAAGGGCATCGTTCTTGAGAAAATCGGTATTGAGG
CTAAGCAGCCTAACTCTGCTATCCGTAAGTGTGCTAGAGTTCAGCTTATCAAGAACGGCAAGAAGATTGCCGCTTTTGTCCCCAAC
GATGGTTGCTTGAACTACATTGAGGAAAATGACGAGGTGTTGATTGCTGGATTTGGGCGTAAAGGTCATGCTGTGGGAGATATTCC
CGGAGTTAGGTTCAAGGTCGTCAAGGTTTCTGGTGTCTCACTCTTGGCCCTCTTCAAGGAGAAGAAGGAGAAGCCAAGATCTTAAA
CAATGCTTTTGAAATTGATTTTGATGTTATAAGAGCCTTTTTGGTAGTTGAATTTCAAAGAACTCTAATGTTCTCTTCTATTCTAC
TTAAGATTCCAAAACTATGTGTTTTAAACTTTTTTTTCTCAATGAGTCTTTGAGTTTAGTTTTGACCTTATTTTTATTTGTATAAC
GAATCAGTTTTCTCCCATTTCTAATCATTTGGATCATATTCTTATTGTGCTCAAAAAAAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_195916 40S ribosomal protein S23-2 [Arabidopsis thaliana]7303e-075
EAZ14059 hypothetical protein OsJ_03983 [Oryza sativa Japonica Group]7133e-073
ACJ84161 unknown [Medicago truncatula]7081e-072
CBI16256 unnamed protein product [Vitis vinifera]7043e-072
NP_001131287 hypothetical protein LOC100192600 [Zea mays]7034e-072

Swiss-Prot top hits (Blast detail)Scoree value
P49201 40S ribosomal protein S23-27302e-076
Q9SF35 40S ribosomal protein S23-17023e-073
P46297 40S ribosomal protein S236942e-072
Q9M5Z9 40S ribosomal protein S236881e-071
Q9GRJ3 40S ribosomal protein S235931e-060

TrEMBL top hits (Blast detail)Scoree value
A2ZZB2 Putative uncharacterized protein7132e-073
B7FHD2 Putative uncharacterized protein7088e-073
B4FBY5 40S ribosomal protein S237033e-072
C5WV32 Putative uncharacterized protein Sb01g0034107033e-072
Q1H5G2 At3g096807024e-072

Arabidopsis top hits (Blast detail)Scoree value
AT5G02960.1 40S ribosomal protein S23 (RPS23B)7311e-077
AT3G09680.1 40S ribosomal protein S23 (RPS23A)7032e-074

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
105  31%
 
122  13%
 
86  38%
 
201  6%
 
181  6%
 
71  6%

Unigene MembersMember information