Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19654

FASTA Sequence
Unigene ID: UN19654Length: 914  SNP
AATATCCAAATCAAACATGTGAGAGAATCGCAACGCGCAACTCTCTCTTCTTTAAATTCCACAAAAAAACCAATCAAACTCCCGGA
AATCGAAAAACCCATTAATCTGAAAATCCGGGGAAAGAAAGATGGAGCCATTGGTGGAAGACGAAGAGTACAGCTTCAGGGAAGTG
GTGTTGCCGTCGCTGATCCCGGTCGTGCCGGAGCCGGAGCTAGAGAGGGAGAACGGAGAGAGGAGAAGAGGGAGAGATGTGATCGT
GGCCGTTGATCATGGTCCCAACAGCAAACACGCCTTTGATTGGGCTCTCGTTCATTTCTGCCGCCTCGCCGATACCCTACACCTCG
TCCACGCCGTCTCAAGTGTTAAGAACGATGTTGTGTACGAGACGAGCCAAGCACTGATGGAGAAGCTCGCTGTTGAGGCCTTTCAA
GTTGCCATGGTGAAGAGTGTGGCTCGTGTTGTTGAAGGGGACGCTGGTAAAGTAATCTGCAAGGAAGCAGAGATATTGAAGCCTGC
GGCTGTCATTATGGGTACCCGAGGCCGGGGCTTAGTGAGGAGTGTGCTACAAGGGAGTGTAAGCGAGTATTGTTTCCATAATTGCA
AATCCGCTCCTGTCATTATCGTTCCTGGGAAAGAAGCTGGAGACGAATCGATTGTCAGTTGGACAAAATCTGGAGATCCTAAACCC
TGAAGAAAATAGCTCTCCAGTCTCTTTGTACCTTTTATCTTTCTCATTGTAGTTGCAGTCCTTGTTTCAGAATGTGTTGTAGAACC
TTCAAGTAATTGTCTTTTGCTATTCTTCTTCTTCTGTGTGTGTATGTGTTTTGTAGTTTCAAGTTTTGTTTATAAAAAATAAAACA
TTTGTTATGTGTATGCAATGGTGTTGTGATGTTATTCAGAAATCGAATTATGAG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_850015 adenine nucleotide alpha hydrolases-like protein [Arabidopsis thaliana]9034e-095
NP_850016 adenine nucleotide alpha hydrolases-like protein [Arabidopsis thaliana]8864e-093
XP_002878561 hypothetical protein ARALYDRAFT_481030 [Arabidopsis lyrata subsp. lyrata]8766e-092
XP_002512913 conserved hypothetical protein [Ricinus communis]8041e-083
ADB85095 response to dessication RD2 [Jatropha curcas]7691e-079

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q9SIJ8 Expressed protein9033e-095
Q94II5 RD2 protein8863e-093
B9RH54 Putative uncharacterized protein8049e-084
D6BR58 Response to dessication RD27691e-079
B9H0S4 Predicted protein7662e-079

Arabidopsis top hits (Blast detail)Scoree value
AT2G21620.1 RD29041e-097
AT2G21620.2 RD28871e-095
AT3G11930.1 universal stress protein (USP) family protein1397e-009
AT3G11930.2 universal stress protein (USP) family protein1397e-009
AT3G11930.4 universal stress protein (USP) family protein1397e-009

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
87  16%
 
615  35%
 
127  16%
 
72  5%
 
201  2%
 
116  14%
 
191  2%
 
94  9%

Unigene MembersMember information