Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19661

FASTA Sequence
Unigene ID: UN19661Length: 961 SSRSNP
GTGTTCAACTTTGAAGTTCCGTTCAACATATTGAACTGAAACGCAATTTTTTTTGTCAACTATATTGAAACATAGTTATACACAAA
CCCATCAATCAATGGTGGTCTTATTATTACGTGGGGTTTTAATGTAATAAACATGACAATGGGTTTTAGGTTCTTCAGTTATATTA
ATCCAAAGCTTATGTGAGCTTATTATTCTTCATCTGCTTCTTTTCTCTCCATTCCTTTATGCTACTTTCTACCTTGGCATTGACAC
GAGCTTGAAAACCTGGATATGGCTCGTACCCGAAAACCATTTGAAGAATCTCAAGCAACACAAAGAAAGGAGCCATGAGAAAAGCT
TGGGCTAGATTGTCTAAAAGCGCAGGTGCTCGTTTCTCGAATAATCCATGTCCAAGAAACTGCCCGGTCCAACATAACAGCTGAGA
TGCTAACCCAACCTTTACGGCAAGAGAAGGTCCTAACCGAACAGCGAGGACACTGGACCCAACCCAGCAAGCGAAACACATGAGAG
CCGCGACGAACCCGGATTTCTTATCCAAACAGATGTAGAACAGAGCATAAGCCACCGTGACGACGAACCCGACGTCTAACCTCAGA
ACGCCGTCGAGGGTCATCGACTGAGGAAACCCTAATTGAGAAAGGTCGTAAATTGGGGAGGCTGGGTAGAGGAGAAGCAAGGCTGT
GAAGACGATGGGCCATACGAAGATGATGTGGATCGCGATGTTGATTGGGTTGCTGTGGTATGCGCCGTAGAAGGCGAAGTGCTTCT
CCAGATCGAGCAATCCCATCTTTAAGAGAGAGAGAGAGAGGATGATAATGTGTTCAGGGAAGAGTTGGTGTAGGGGGGGATTGAAA
TAGTATCGTCACCTTCGCTTAAACTGGAAGATTACAGAGAGACACGGGAAGAAGACGATAAAGGTAAGATTTTATGCTAACGTGCG
CTTTTTAAAGTGCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002893011 hypothetical protein ARALYDRAFT_889295 [Arabidopsis lyrata subsp. lyrata]8793e-092
NP_564061 uncharacterized protein [Arabidopsis thaliana]8712e-091
NP_177584 uncharacterized protein [Arabidopsis thaliana]8409e-088
CAN69808 hypothetical protein VITISV_019656 [Vitis vinifera]6742e-068
XP_002284835 PREDICTED: hypothetical protein [Vitis vinifera]6723e-068

Swiss-Prot top hits (Blast detail)Scoree value
O13737 Uncharacterized endoplasmic reticulum membrane protein C16E8.021971e-014
P25338 Uncharacterized endoplasmic reticulum membrane protein YGL010W1622e-010

TrEMBL top hits (Blast detail)Scoree value
Q9M9U3 At1g18720/F6A14_178712e-091
Q9CA70 Putative uncharacterized protein F1M20.128406e-088
A5B816 Putative uncharacterized protein6741e-068
B9HI88 Predicted protein6712e-068
A9PDL0 Putative uncharacterized protein6703e-068

Arabidopsis top hits (Blast detail)Scoree value
AT1G18720.1 unknown protein8727e-094
AT1G74440.1 unknown protein8404e-090

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
105  16%
 
88  25%
 
65  16%
 
1111  34%
 
91  3%
 
72  6%

Unigene MembersMember information