Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19680

FASTA Sequence
Unigene ID: UN19680Length: 1138 SSR 
GACGCTTCAAAACGAAGTTATTTAAGGTAGAGAATATTTTCTTGCGTCTAGAGAGAGAGAGAGATGGGGGGTGTGGTGGAGGAAGC
TCACAACGTGAAGGTGATTGGCTCAGGAAATCAAGGGACGATCGTATTAGGTCACGGGTTTGGCACGGACCAGTCAGTGTGGAAAC
ACTTGGTTCCACATCTGGTCGATGATTACCGCATCGTGCTCTACGACAACATGGGAGCCGGTACGACCAATCCTGAATATTTCGAC
TTTGAACGTTACTCAACTCTCGAAGGTTTCTCTTTTGATTTGATTGCAATTTTAGAGGATCTTCAAATCGAGTCTTGTATCTTTGT
TGGTCACTCTCTATCCGCCATGGTTGGTGTCTTGGCTTCTCTTAACCGACCTGACCTCTTCTCCAAAATTGTCATGATTTCTGCTT
CCCCACGATACGTGAACGATGCTGATTACCAAGGTGGGTTCGAGCAAGACGATCTAAACCAACTTTTTGAAGCGATGCGAAGCAAC
TACAAAGCGTGGTGCTTAGGTTTCGCTCCACTCGCGGTAGGTGGAGACTTAGACTCAGTAGCCGTTCAAGAATTCAGCAGAACGCT
CTTCAACATGCGTCCGGACATAGCACTTTCCCTGGCTCAGACCATTTTCCAAAGCGACATGAGACAATTGTTACCTTTTGTCTCTG
TCCCTTGTCACATCGTCCAAAGCGTTAAAGATTTAGCCGTGCCGGTCGCCGTATCCGAGTATCTTCACAAAAATCTCGGATGTGAA
TCTGTCGTCGAGGTTATGTCTTCAGATGGTCACCTTCCTCAGCTTAGCTCGCCGGACTCTGTTATTCCCGTTCTACTCCGTCATAT
CCGCAACGACATTGCTGTATGATGATGAGAGGAGATGTTAATTAAGTTTAGCGAAATTAAATGTATGATGTGATATGTCTGGCTGG
GTAAGTGAGTATATCGTATCGTTGTCGTTTGTTCTTGGATTCTGAATTTGATCAGTTTGTTGTTGTTCTTATCTTTGTGTTAAACG
AAAAGTCTTGGTCTCTTGTGTCCAGCTTTACTCGACCTCGTTATTTGTTCTTATTTGTTGTACTCAATATAAATGCAGTAATAACG
ATGTTCGTGATTGATGGTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002866945 hypothetical protein ARALYDRAFT_912591 [Arabidopsis lyrata subsp. lyrata]12916e-140
NP_195463 hydrolase, alpha/beta fold family protein [Arabidopsis thaliana]12891e-139
XP_002524966 sigma factor sigb regulation protein rsbq, putative [Ricinus communis]11771e-126
XP_002307293 predicted protein [Populus trichocarpa]11609e-125
XP_002284043 PREDICTED: hypothetical protein [Vitis vinifera]11554e-124

Swiss-Prot top hits (Blast detail)Scoree value
O07015 Sigma factor sigB regulation protein rsbQ4732e-046
O05235 Uncharacterized hydrolase yugF1443e-008

TrEMBL top hits (Blast detail)Scoree value
Q9SZU7 Putative uncharacterized protein AT4g3747012897e-140
B9SG47 Sigma factor sigb regulation protein rsbq, putative11777e-127
B9H6L8 Predicted protein11606e-125
A5B7C0 Putative uncharacterized protein11552e-124
A9PJB4 Putative uncharacterized protein11428e-123

Arabidopsis top hits (Blast detail)Scoree value
AT4G37470.1 hydrolase, alpha/beta fold family protein12903e-142
AT3G03990.1 esterase/lipase/thioesterase family protein7473e-079
AT3G24420.1 hydrolase, alpha/beta fold family protein5636e-058
AT5G19850.1 hydrolase, alpha/beta fold family protein1282e-007
AT4G36530.1 hydrolase, alpha/beta fold family protein1155e-006

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
121  6%
 
111  6%
 
84  24%
 
72  12%
 
181  6%
 
193  18%
 
64  24%
 
101  6%

Unigene MembersMember information