Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19684

FASTA Sequence
Unigene ID: UN19684Length: 1360  SNP
TTAGACAAACGTGAAATAGTCCGAGCTAGAGAAGTTTGTCTTGATGAGAAATGGAAGCTCAAATTCTGTTTCTCTATTTCTCACTC
CTCGTTCTCTCTCTAAATTTCTTATTTCAGTATATCAAACCAAGGCTAAGCCGCATGTTCCAGCCTTCTCTTGAAACTCAAGCCAA
GGCCGCCATTTTATCAAGAAAAGAAGTAGCCGAGTTTCTTGATTCTCCCATTGTGGAAGTAGTAGAAGATGAAGATATAAATACAA
CTTCTAGTTCCACGTTCGATTTTGATCCATACATGACGAGTAAAGCCGATGCAGTGAACAAAGCTCTAGAAGAAGCCATACCTGTC
GGGGAGCCACTCAAGATCCACGAAGCCATGCGTTACTCGGTTCTTGCAGCCGGTAAACGTGTAAGGCCTATTCTCTGCCTCGCTTC
TTGTGAGCTAGTAGGCGGCGAAGAAACGCCGCGATGCCAGCGGCTTGTGCGGTTGAGATGATCCACACCATGTCTCTTATCAAAGA
CGACTTGCCTTGTATGGACAATGACGATCTGCGTCGTGGGAAGCCCACCACTCACAAAGCCTACGGCGAAGGAGTCGCCATTCTCT
CCGGAGGAGCTCTCTTGTCTCTTGCGTTTGAGCACATGACAACGGCGGAGATATCCTCGGATAGAATGGTTTGGGCGGTCAGGGAA
CTGGCTAGGTCCATTGGAACTAGAGGGTTAGTCGCGGGACAAGCCAAGGACATAAGTAGTGAAGGTTTGGAGTTGAACGACGTCGG
TTTAGAGCATTTGGAGTTTATCCATGTACACAAAACTGCTGTTTTGTTGGAAACTGCTGCGGTTCTTGGAGCCATTATTGGTGGTG
GATCTGATGAAGAGATTGAGAGTGTAAGAAAGTTTGCCAGGTGCATTGGATTGTTGTTTCAGGTGGTGGATGATATTTTGGACGAG
ACCAAGTCGTCGGAGGAATTGGGAAAAACCGCCGGAAAAGATCAGCTACTTGGAAAGCTGACGTACCCCAAGCTGATGGGGTTGGA
GAAATCCAAAGAATTTGTTAAGAGATTGACTATAGATGCACGTCAACATCTTCATGGGTTTACTACGGAGAAGGTGGCACCTTTAG
TAGCTCTTACTAATTTTATTGCCAATAGAAATAAATGAAATGTTATGTCTTTTAGAACTTTGATTGTTTGTTTTGTTGTGTCGGGT
TTATGTATACATGCTAAAACAGTGTGCTTACTTTTAACTTTTAAGTGTAACCATGTTTTTATATTTTTATTTAAAATTCAAAAAGG
GAAAAACCGGAAAAAAAAATCTATTTGCCTCTTTTGTATATTAGATAATAAAGAACGGCTTTCTGAGAGC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002880528 geranylgeranyl pyrophosphate synthase [Arabidopsis lyrata subsp. lyrata]11197e-120
BAA19583 geranylgeranyl pyrophosphate synthase [Arabidopsis thaliana]11152e-119
NP_179960 geranylgeranyl pyrophosphate synthase 4 [Arabidopsis thaliana]11152e-119
AAB67730 pregeranygeranyl pyrophosphate synthase [Arabidopsis thaliana]10982e-117
NP_179454 geranylgeranyl pyrophosphate synthase 3 [Arabidopsis thaliana]9503e-100

Swiss-Prot top hits (Blast detail)Scoree value
O04046 Geranylgeranyl pyrophosphate synthase 211158e-121
Q9SLG2 Geranylgeranyl pyrophosphate synthase 49501e-101
Q43133 Geranylgeranyl pyrophosphate synthase, chloroplastic/chromoplastic8792e-093
P34802 Geranylgeranyl pyrophosphate synthase 1, chloroplastic8675e-092
Q9LUD9 Geranylgeranyl pyrophosphate synthase 3, chloroplastic7941e-083

TrEMBL top hits (Blast detail)Scoree value
B6DVJ8 Geranylgeranyl pyrophosphate synthase 211151e-119
A0MEM8 Putative uncharacterized protein (Fragment)9502e-100
Q0WUL9 Geranylgeranyl pyrophosphate synthase8678e-091
Q8LAW5 Geranylgeranyl pyrophosphate synthase8507e-089
A0MEM7 Putative uncharacterized protein (Fragment)8472e-088

Arabidopsis top hits (Blast detail)Scoree value
AT2G23800.1 GGPS2 (GERANYLGERANYL PYROPHOSPHATE SYNTHASE 2); farnesyltranstransferase11166e-122
AT2G18640.1 GGPS4 (GERANYLGERANYL PYROPHOSPHATE SYNTHASE 4); farnesyltranstransferase9501e-102
AT4G36810.1 GGPS1 (GERANYLGERANYL PYROPHOSPHATE SYNTHASE 1); farnesyltranstransferase8683e-093
AT2G18620.1 geranylgeranyl pyrophosphate synthase, putative / GGPP synthetase, putative / farnesyltranstransferase, putative8487e-091
AT3G14510.1 geranylgeranyl pyrophosphate synthase, putative / GGPP synthetase, putative / farnesyltranstransferase, putative8092e-086

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
1012  24%
 
114  8%
 
129  18%
 
65  10%
 
79  18%
 
97  14%
 
83  6%

Unigene MembersMember information