Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19693

FASTA Sequence
Unigene ID: UN19693Length: 1732 SSRSNP
AACTTTGAAGTATAGTATGAACATATCAATAATTCGAAGCTTAAACGAAAAAAGAAAATAGACAAGTTACAATAGTATTCATAGGC
GGAAAATACACATTTATAATTTCTCTCTCTCTCACAAAGATTAAAAAAAACTTGAACAGATAAAAAGGGAAATTAACGATAAAGTT
TTGGCAACTATCCGGCGATTTTGTAACTGGGGTTGACGAGATTGTCTAAACCGGAGACAACTTGAATGGACTCAATGACATCACCG
ACTTTAAGATCAGCCAGAAAATCTTCATTCTGAGTAACGTAACCGAAGACAGCGTAACGACCGTCCAAGATGTTGGAATTGCTTGG
GGTCAGCTCACTCTCTTTCAGCAGCCAAAACACTTGGCTCGATCCCGAGTCATTCTCAAACTCTTCTCTAGCCATAGCCATTGTTC
CAAATGCGTTGAAAGGAAGCATAACCTGAGCCTTGTACAGACCCAATTCTTCAAGGGTAGAGCCGTAAAAAGGAGTCTTCTTGCCA
GCCACCATAATCTCAAGAGGAACAGTCCTCACTTTCTCAGTGCTTGGATCTATAAATCCTTCCGCAGGACCCTCTGGATCTCCCGT
TTGTACCACAAACCCATCAGATCTCTGGATCTCCATGCCATCGTAGAAATGGCGCTCCACCAAGTCGACAAAGTTCCCGGCGGTAA
CAGGGGCGTTGTAACCATCGAGGACAATACGGAAGACACAATCCTGGAGGTTAGGGTTGTCCTTGATCTTGACTTTCATGTCGAGA
GTGGCTCTTCCTTTGAGAAGAGGCATGTTACGGTACTCATCAGGGACTTGATAAGGGAAGCCATCGACCATATCCTCTTCAATTCC
GCCAACAAATTGGAGAATCTCTTTCTGTTTAGGAGAAACCGCATCTCTCTTCCGATCTTCCACAATCTGAAGCATGTCTTGCATAC
CAGCTTCCAACTGTTGAATCAGTTGGTTACCGTGATCCTTCTTGGAGTCAGCAAAACCAGACACAATCATGCTTTTCCCTTGCTGA
AGTGATCTATTTGCTTGCCTCACATTACGTTCAACAGAATCGAGGGCCTTGAGGCCAGAAATCTTGAGGCTGTCAGTGATATCCTC
GAGAGGCTTCTGAACTTCTCTGATGGCTTTGTTGTCGATAGGCAATGCATATCTTAACAAGGCTCCTGGGTCTTTGATGGGAGGTC
CTGATATCAACACCGACACCTCTGGAATCGCTGGGTTTGCTACGGCGTAAGCAGCAGCAGCAGCAGCAGCAGCAGCATTGGCATTG
GCATAGGGAGGGGAAGCAATGGAAGGGACTACTCCTCCAGCTATCAAACCCAACGATAAAGCTAATGAAATCGCAGTTTCTCTCAA
TAATCTCCCTCTCTGCTGCTGAATGTCGCCTGAGGAACAACAACGAACAACTCCGATGCGTTTTTTGGAGTCATAAGACTCGATTC
TCCTTCTCGACGCATTCACCAAACTAAACGTAGGCAGTGAGGCTAACGATGCCGCCATTTCCAGATTTTATTTTTTAAAAATATAA
AGGGTTTGAAGAGAGGCAGATAATGATTTTCAGTGACAGCCCTGATGAATCATCGACATTTGATATTGTGAACTTTTTGTTCTCTA
GTAGTAGTTAGTAAAGTATGTAATGATTTTTTTGATATAAGAGAAGGAAGGAGATGGAAAGAGGATAAGGGGTTTATGACTCTCAC
TTCTCCGGATCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002884278 hypothetical protein ARALYDRAFT_477375 [Arabidopsis lyrata subsp. lyrata]17211e-189
NP_186797 peptidyl-prolyl cis-trans isomerase CYP38 [Arabidopsis thaliana]17068e-188
BAH20293 AT3G01480 [Arabidopsis thaliana]17068e-188
XP_002517345 peptidyl-prolyl cis-trans isomerase, putative [Ricinus communis]15965e-175
XP_002323806 predicted protein [Populus trichocarpa]15705e-172

Swiss-Prot top hits (Blast detail)Scoree value
Q9SSA5 Peptidyl-prolyl cis-trans isomerase CYP38, chloroplastic17063e-189
O49939 Peptidyl-prolyl cis-trans isomerase, chloroplastic15227e-168
Q55118 Putative thylakoid lumen peptidyl-prolyl cis-trans isomerase sll04087271e-075
P72704 Probable peptidyl-prolyl cis-trans isomerase sll02273362e-030
P82869 Peptidyl-prolyl cis-trans isomerase CYP37, chloroplastic1525e-009

TrEMBL top hits (Blast detail)Scoree value
B9DHS6 AT3G01480 protein (Fragment)17065e-188
B9RUU4 Peptidyl-prolyl cis-trans isomerase, putative15963e-175
B9IJN4 Predicted protein15703e-172
C5YKK8 Putative uncharacterized protein Sb07g01932015158e-166
B6U5I1 Peptidyl-prolyl cis-trans isomerase15094e-165

Arabidopsis top hits (Blast detail)Scoree value
AT3G01480.1 CYP38 (cyclophilin 38); peptidyl-prolyl cis-trans isomerase17072e-190
AT3G01480.2 CYP38 (cyclophilin 38); peptidyl-prolyl cis-trans isomerase12233e-134
AT3G15520.1 peptidyl-prolyl cis-trans isomerase TLP38, chloroplast / thylakoid lumen PPIase of 38 kDa / cyclophilin / rotamase1525e-010

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
121  5%
 
84  21%
 
117  37%
 
93  16%
 
62  11%
 
192  11%

Unigene MembersMember information