Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19705

FASTA Sequence
Unigene ID: UN19705Length: 773  SNP
GATGGGTAAAATTTACTCTTTTGAAAGCATTAATTAACAAGGATACATATATTCAACTGATAGACTGAAAATATATGAAACCTCGA
GATTTATCACACGTAATTAACAACATCAAAGCATATCAAAATACCCAAACAGCAATATATTGTAACTGATGAACCATACAAGAGCC
CCATTTATTATAACATAATACGAAGGCGCGCGCACACAAACACACACAAAGGCAGCCATATATAACGGTGGGGGATCTGGTGATGA
TGGTTTGAAACGGACTTAGGATTTGATAACGTGGTGATCCATGTCCGCAGCGAGGCTCTTGACGAACTTCATGTAGTTGATGGGTT
CAGGCGAGTCATCGGTTCGCTTCTCCCATATCATAGTGACCTTGCAGACTATATCACTAGGCGACTTTTGAATGAACTGAAAGGTG
ACGTCATACACTTTAAGCTGCTCCATTACGTGACCTTCGAGCCCTTTGAGCGTTACCGCCATATTCTCATCGTCATTCTCTCTCCT
CTCCTTGAACACCTCTTGTTTCCCATCGCATGTGTAGTTCCAAATCTTGATGGATCCATGAGAGTCCCATTCACCATCGTGGACGG
TGACACCTTGAATGAGGTGGCCAATGGCGTCGGGGAAGAGATGGTTCTCATTCTTCCACCTCTTGTAGTGTTTCTCCGCCGATCCT
TTCAAAGGAACCTCCGTCACATATGTTCCTGACGTCGCCATCTCTGATCTTTCTTTTTTTGTTTTTGTTCTTTTGGCTTTTGAAT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_565264 MLP-like protein 328 [Arabidopsis thaliana]7322e-075
XP_002875203 hypothetical protein ARALYDRAFT_322644 [Arabidopsis lyrata subsp. lyrata]7322e-075
XP_002875076 hypothetical protein ARALYDRAFT_904347 [Arabidopsis lyrata subsp. lyrata]7278e-075
XP_002870338 hypothetical protein ARALYDRAFT_493506 [Arabidopsis lyrata subsp. lyrata]7161e-073
NP_565265 MLP-like protein 329 [Arabidopsis thaliana]7081e-072

Swiss-Prot top hits (Blast detail)Scoree value
Q9ZVF3 MLP-like protein 3287329e-077
Q9ZVF2 MLP-like protein 3297086e-074
Q9SSK7 MLP-like protein 342094e-016
Q9SSK9 MLP-like protein 281791e-012

TrEMBL top hits (Blast detail)Scoree value
C0SV41 Putative uncharacterized protein At2g01530 (Fragment)7089e-073
O23267 AT4g14060/dl3070w7071e-072
Q39132 At1g14950/F10B6_186641e-067
B2WS86 Major latex-related protein6326e-064
Q8LDJ8 Major latex protein, putative6317e-064

Arabidopsis top hits (Blast detail)Scoree value
AT2G01520.1 MLP328 (MLP-LIKE PROTEIN 328); copper ion binding7337e-078
AT2G01530.1 MLP329 (MLP-LIKE PROTEIN 329); copper ion binding7094e-075
AT4G14060.1 major latex protein-related / MLP-related7085e-075
AT1G14950.1 major latex protein-related / MLP-related6647e-070
AT4G23680.1 major latex protein-related / MLP-related6281e-065

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
614  31%
 
912  27%
 
123  7%
 
82  4%
 
105  11%
 
203  7%
 
75  11%
 
111  2%

Unigene MembersMember information