Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19714

FASTA Sequence
Unigene ID: UN19714Length: 1344  SNP
GGCTTTTAAGATGGTTAATCCTTTGATAACAACTTCAAGATAGTTTTCAAGGCGACAACACAATGACTGATGCTTGTCATGTTAAT
GTCATTTAATGAAAGCTCATCCCAAAGAACTTGTCTAAAGCAGGTACTACACTAGAGGGGAGTTTAAACGAAAAACAGTGTGCATA
TTTGCCTCATAAACCGGGTAAAAGCAAAGTCAATTTGCACTTGCGTAAGACAAAACAAAAGAACAACTTCACGATGTAATCATCGG
CTCTGGTTCTGACGGGTCGCTGGGAGTTTTGTCGGACTGGCGTGCTGAGTTGAACAATATGTCTTTGATAACCTGTGACATTAATC
CATGGACCTGCTCAACAGTTATCTTTGCACTATCCCGAGTTATCTTAGCCAGTGGAGGCTCATCCTCTTTCTTCCTGTGAAGACTG
GCCGGTATTCCTCCAAACCGGGAGTGAGCCAGCTGACTCTCGGCTTGCTCAAGCTTCTCAGCCAAGTCTGATATCTGTCCGGCCAC
ATAGTCTCCATTGCCCAGCAGTGGGGAAGAAGAAAGAGTGTTCACCCAGTACTTGTTCCAAAGGAGATCCAGAAGGTGGCTATCAA
GAGATGACTTGAAATAAGTGATGTCCAACGAATAGTACTGTTTGCAATGAACACCAAAGTCCTCAATCTTGTTCAAAGGGATAGTC
TGATACTCAGAAACATGATCATCAGAGATCTTATGCCCCTCAGGATAAGTCCTGAACGCCCCAATCTCAACCTTACCAGCCGAAAC
AGTCCTCGTCGGATCAATCACAACAGCCAAGAAAGGCTCCTGATACTGCTGGTTAAGCATCTGCGTTGAGACATCGATACCCGAGA
GCCAGCATCCATACCCAGGGTGTGAGTGATACCATCCCACAACATTCTCCAATCTCCCAGCCAGCTTGTTGGTCTGAGAGTACTCA
ACCATGTACTCATAAGCATCAGCCTGAGCATTAACCCTAGTCTCGGTTCCTTCGACAGGCAAAGCGAAGGCGTCCATGACGATGAT
GGTGTCGCCATCGGTCTTCCCCTGCATAAGACCCATGATCTCGATCGTGCCGCCGGAGCGCGCGTGGACGACCATCTTGAGGAGCG
CGAGTGCCGAGATCTGGACGCGCTTGAAGTAGTTGGGGTCGGAGGTCCACGGCTTCTCCTGCTGGACCTTGGTCTGAGAAGCTTCG
TCGTAGTAGAATATTCCGTCGGAGGAGGATGAATCGGGTTGTTCCACGGTGAGGATGTTGTTCTCGAGCTCCCATGTCTTGCGAGC
GATGGTAGAAGGATCGTCCATTGTTGGTGATTTTGATCAAATCGCGAGAATCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAJ34114 unnamed protein product [Thellungiella halophila]17433e-192
XP_002893252 hypothetical protein ARALYDRAFT_472541 [Arabidopsis lyrata subsp. lyrata]16976e-187
NP_173705 COP9 signalosome complex subunit 5b [Arabidopsis thaliana]16662e-183
AAM65053 putative JUN kinase activator protein [Arabidopsis thaliana]16662e-183
AAC36344 AJH1 [Arabidopsis thaliana]16538e-182

Swiss-Prot top hits (Blast detail)Scoree value
Q8LAZ7 COP9 signalosome complex subunit 5b16661e-184
Q9FVU9 COP9 signalosome complex subunit 5a15933e-176
Q6P635 COP9 signalosome complex subunit 511848e-129
Q6GLM9 COP9 signalosome complex subunit 511784e-128
Q92905 COP9 signalosome complex subunit 511741e-127

TrEMBL top hits (Blast detail)Scoree value
A1A6G7 At1g2292016662e-183
D6CIB3 CSN5 protein15641e-171
O81090 Putative JUN kinase activation domain binding protein15622e-171
Q3E7P2 Putative uncharacterized protein At1g22920.215603e-171
B7FI77 Putative uncharacterized protein15586e-171

Arabidopsis top hits (Blast detail)Scoree value
AT1G22920.1 CSN5A (COP9 SIGNALOSOME 5A)16677e-186
AT1G71230.1 CSN5B (COP9-SIGNALOSOME 5B); protein binding15933e-177
AT1G22920.2 CSN5A (COP9 SIGNALOSOME 5A)15602e-173
AT5G23540.1 26S proteasome regulatory subunit, putative3244e-030
AT5G23540.2 26S proteasome regulatory subunit, putative2681e-023

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
95  29%
 
62  12%
 
103  18%
 
122  12%
 
203  18%
 
191  6%
 
211  6%

Unigene MembersMember information