Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19747

FASTA Sequence
Unigene ID: UN19747Length: 1334  SNP
GGGCATTCAAAGAAAGAAGGGGTAATCGGCACTAACACAGGAGGAGATTACATCGAGGGAGATACCATTTTCCTCCACGTCGGAGG
TTTGGTACTACACGTCTCCTAAGTTTGTCCTGTCAGAATGGAAGGTTCAAGCAGTCTATCCAACGCAGGAAATTTTGGATCTATTG
GAAGACAATCACAAGCTTCCCCAAATAACAGGGATAATAGTATTTCTCCTCCAAGTAATATGCACCATCATCATAGTGCTTCTTTA
AATAATCTTCTCATAGATGAGCAACCAGCTTGGCTCGATGATCTCCTAAGCGAGCCAGCGTCTCCCAAGATCAACAAAGGTCACAG
GCGTTCAGCTAGTGACACATCTGCCTACTTAAACTCGTCTTTAATGCCTTTTAGAGAAGATGACCTTCTGAATAGTCATTTTTCTG
GGCCATCTTGGCTAGTCCAGAATATTCACCAGCATGATGATTTGTGGCATCCTAACTCTTACGACAACCACAGTAAATTGGGATGG
GAGTTTTCTAACAAAACTGGAACTAACCTCCAAACACATGTGTCATGGGGAGCTGTAAATAGAGCAGGTACCTCTGCCTCGAAATC
AGCTGAAATACAAGCAAGTAAAATGAAAGAAGGCTCTTTAACAAAACCAGACGGTCCTGGATCAAAAATTGACTCTAAACGTATCA
AACACCAAAATGCTCACCGGGCACGTTTAAGGAGGCTTGAGTACATATCAGATTTGGAAAGAACCATCCAAGTGCTACAAGCTCAA
GGATGTGAAATGTCATCTGCCATTCACTACTTGGATCAACAGCTGGTCATGCTTGGTATGGAAAATAGAGCCTTGAAACAACGTCT
GGATAGTTTAGCAGAAATCCAAAAACTTAAACATGTTGAGCAACAATTCCTTGAAAGAGAGATAGGAAATCTGAAATTTCGAAAGC
ACCAACAACAACCACAACAGAATCAGAAACAAACGCAGCAAAACAGATACAACAACTACCGCCCACCCACCACGCAGGAACCCGAG
TCCCAGTTTGCAGCCTTGGCGATATGATTTTAGGAAAATATGGATCCACTTCCAGTTAAATTTCTCAGTATGCTCTATAAGGTCTT
ATAAACATTTTTCTCAGTGTTCATATACGATAGGTAAGCCCAGTAATGCTTGCAGTCTGGAATGAATGCCTGAGCAAAGTATAGTC
ACATATTTTATAATGTGGATGTTCAAATTCTTATTTTTATATAATTATTTTTATTAAAGTTGTGTAAGAGTCTATGAAACAACTCT
ATCATGTTAATTATCTTGTAATATATATACTATTAATTTTCTAC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002891186 hypothetical protein ARALYDRAFT_473679 [Arabidopsis lyrata subsp. lyrata]11171e-119
NP_564460 bZIP family transcription factor [Arabidopsis thaliana]10669e-114
AAM64869 unknown [Arabidopsis thaliana]10174e-108
AAF79361 F15O4.49 [Arabidopsis thaliana]10094e-107
XP_002266061 PREDICTED: hypothetical protein [Vitis vinifera]3231e-027

Swiss-Prot top hits (Blast detail)Scoree value
Q8W3M7 Uncharacterized membrane protein At4g065981462e-008

TrEMBL top hits (Blast detail)Scoree value
C0SUZ3 Putative uncharacterized protein At1g35490 (Fragment)10666e-114
Q8LBB0 Putative uncharacterized protein10173e-108
Q9LQD6 F15O4.4910093e-107
A5B6S2 Putative uncharacterized protein3239e-028
B9T452 Transcription factor RF2a, putative3131e-026

Arabidopsis top hits (Blast detail)Scoree value
AT1G35490.1 bZIP family transcription factor11131e-121
AT2G42380.2 bZIP transcription factor family protein1873e-014
AT2G42380.1 bZIP transcription factor family protein1481e-009
AT4G06598.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; BEST Arabidopsis thaliana protein match is: bZIP family transcription factor (TAIR:AT1G58110.2).1462e-009
AT5G04840.1 bZIP protein1301e-007

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
93  25%
 
112  17%
 
62  17%
 
82  17%
 
101  8%
 
72  17%

Unigene MembersMember information