Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19769

FASTA Sequence
Unigene ID: UN19769Length: 1903  SNP
GGGGGAAGAGGATGGAAAAACCATTTGGGCCATGAGGCTTAAAGCAAGTCTTGATCGAGCACGGAGATTAACAGCAGAATACTCTG
ATTTACTTCTTCAAATATTCCCTCCTAATGTGGAGATACTAGGAAGAGCTCTAGGTATTCCAGAGAACAGTGTCAAGACCTACACA
GAAGCAGAGATTCGTGCTGGTATAATTTTTCAGATCTCAAATCTCTGCACTGTTCTTCTAAAAGCTGTAAGAAACTCACTTGGTTC
TGAAGGCTGGGACGTCATTGTACCTGGATCAACTTCCGGGACATTAGTTCAGGTTGAGAGCATTGTGCCTGGATCATTACCATCAA
CTGGTGGTGGTCCTATTATTCTCTTGGTCAACAAAGCTGACGGCGACTAAGAGGTAAGTGCTGCTAATGGGAACATAGCCGGAGTC
ATGCTTCTCCAGGAGTTACCTCACTTGTCTCACCTTGGTGTCAGAGCACGGCAGGAGAAAATTGTCTTTGTGGCATGTGATGATGA
TGACAAGGTGGCTGATATAAGGCGACTTGTAGGAAAATATGTCAGGTTGGAAGCATCTCCAAGCCATGTAAACCTTATTCTTTCAA
CTCAAGATAGGAGTCGTACTCCCAAATCCAAATCAAAATCTGATGCTAAGAAAAAAACTGATAAGAAGAGTGTATCTAAGGATGAT
GAAGAGTCAAAGCCTGTCTCCTCATCTTCTGATAGGCTCCTTTACTCATCCAAGGATATCCCTAGTGGAGGAATCATAGCACTTGC
GGATTCAGATGCATCAACCTCTGGTTCAAAAGCTGCTGCTTGTGGTCTTCTTGCATCTTTAGCAGCAGCCTCTACTAGAGTGGAGA
GCGAGAACGGAGTTCCAGCATCATTCAAGGTTCCAGCTGGAGTTGTCATACCTTTCGGATCAATGGAGTTAGCTTTAAAGCAAAGC
AACTCAGAAGAAAAGTTTGCATCTCTGTTAGACAAGTTAGAAACAGCCAGACCTGAAGGCGGTGAGCTAGACAACATATGTGACCA
GATCCACGAAGTGATGAAGTCACTGCAAGTGCCTAAAGAAACAATCAACACCATAAGCAAAGCGTTTCCCCAAGACCAAGACGCTG
CTCGTCTCATCGTTCGTTCAAGCGCCAACGTCGAGGACTTAGCAGGAATGTCAGCAGCAGGACTCTACGAATCAATCCCCAACGTG
AGCCCCTCGGATCCTTCGGTGTTTTCAGATTCCGTTTGCCAAGTTTGGGCTTCTCTCTACACGAGAAGAGCTGTTCTAAGCCGTAG
AGCTGCTGGTGTCTCTCAGAGAGAAGCTACAATGGCGGTTCTTGTTCAAGAGATGCTGTCTCCTGACTTATCTTTCGTTCTTCACA
CGGTGAGTCCAGCTGATCCGGACAGCAACCTGGTCGAAGCTGAGATAGCTCCTGGTTTAGGTGAGACTTTAGCTTCGGGGACGAGA
GGAACACCGTGGAGACTTGCTTCGGGTAAGCTCGATGGGGTTGTGGAGACCTTAGCGTTTGCAAACTTCAGTGAAGAGCTTCTTGT
GTCAGGAAAAGGTCCTGCTGATGGAAAATACGTTCGGTTGACCGTTGACTATAGCAAGAAACGGTTAACGGTTGACTCGGTGTTTA
GACAGAAGCTCGGTCAGAGACTCGGTTCGGTTGGTTTCTTCTTGGAAAGGAACTTTGGATGTGCACAAGACGTTGAAGGTTGTTTG
GTTGGTGAGGATGTCTACATCGTTCAGTCAAGGCCACAACCTCTGTAGAATCTTTTTTTTTTATGTTCTATAAAGCGAATAATAAC
AAAAATGTTAAAATAAAATCTGCAGTTATGTCATTATCATATGTGAAGTATGTTTAATAATGATACACATATATCTTAATTACTAT
ATTTTAAAGCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAO64153 unknown protein [Arabidopsis thaliana]26782e-300
AAU93516 chloroplast alpha-glucan water dikinase isoform 3 [Arabidopsis thaliana]26772e-300
NP_198009 phosphoglucan, water dikinase [Arabidopsis thaliana]26772e-300
XP_002872212 hypothetical protein ARALYDRAFT_489476 [Arabidopsis lyrata subsp. lyrata]26763e-300
AAC26246 contains similarity to phosphoenolpyruvate synthase (ppsA) (GB:AE001056) [Arabidopsis thaliana]26575e-298

Swiss-Prot top hits (Blast detail)Scoree value
Q6ZY51 Phosphoglucan, water dikinase, chloroplastic26771e-301
Q2QTC2 Phosphoglucan, water dikinase, chloroplastic17843e-198
Q9SAC6 Alpha-glucan water dikinase 1, chloroplastic2441e-019
Q9AWA5 Alpha-glucan water dikinase, chloroplastic2225e-017
Q9V2H7 Probable phosphoenolpyruvate synthase2216e-017

TrEMBL top hits (Blast detail)Scoree value
Q0WQR4 Putative uncharacterized protein At5g26570 (Fragment)26781e-300
D2JRZ6 Glucan/water dikinase18698e-207
B9GCR7 Putative uncharacterized protein17846e-197
Q0INT3 Os12g0297500 protein17846e-197
B8BP85 Putative uncharacterized protein17837e-197

Arabidopsis top hits (Blast detail)Scoree value
AT5G26570.1 ATGWD3; carbohydrate kinase/ catalytic/ phosphoglucan, water dikinase26786e-303
AT5G26570.2 ATGWD3; carbohydrate kinase/ catalytic/ phosphoglucan, water dikinase11024e-120
AT1G10760.1 SEX1 (STARCH EXCESS 1); alpha-glucan, water dikinase2441e-020
AT4G24450.1 PWD (PHOSPHOGLUCAN, WATER DIKINASE); ATP binding / kinase1751e-012

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
122  22%
 
211  11%
 
82  22%
 
202  22%
 
111  11%
 
91  11%

Unigene MembersMember information