Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19781

FASTA Sequence
Unigene ID: UN19781Length: 1438 SSRSNP
CTCCTTTCCTCTTCACTAAACTCCAACTCCATTATTCAATATACAATCTTCGTGACTCTACAGTTCTCTCTCTCTCGCTCGAATCT
TAGAAACTATGGCTTCATCTACTAAAACGGTTATGATCCCTATTGCTCACGGTACCGAGCCTCTGGAAGCGGTGGCGATGATCACC
GTCTTGCGGAGAGGTGGTGCTGATGTGACGGTGGCGTCTGTCGAGGATAAAGTTGGCGTTGATGCTTGTCATGGCATCAAGATGGT
CGCTGATACTCTCCTCTCCGATATCACCGACTCTATTTTCGACCTTATTGTTCTCCCCGGAGGGCTTCCCGGTGGCGAGACTCTTA
AGAACTGCAAACCATTAGAGAACATGGTGAAGAAACAAGACACAGATGGAAGACTTAACGCAGCGATCTGTTGTGCTCCTGCTTTG
GCTCTTGGTACTTGGGGTCTTCTAGAAGGCAAAACAGCAACTGGTTACCCTGTTTTCATGGAGAAACTTGCGGCTACTTGTGCAAC
TGCTAGTGAGTCAAGAGTGGAGATAGATGGAAGGATTGTCACAAGTCGTGGACCAGGAACCACCATTGAATTCTCCATCACTCTTA
TTGAGCAGTTGTTTGGGAAAGACAAAGCTGATGAAGTCTCTAGTATCTTGCTGGTTCGTCCTAATCCTGGTGAGGAGTTTACCTTT
ACCGAGCTTAACCAAACCAACTGGTCGTTCGAAGATACTCCACAGATTCTTGTCCCCATTGCAGAGGACTCTGAGGAGATCGAAGC
TATTGCACTTGTAGATATCCTGAGGAGGGTAAAAGCAAATGTCGTGATAGCTGCAGTTGGTAACAGTTTAGAAGTGGTAGGATCTC
GCAAATGTAAGCTAGTTGCAGATGTGCTTCTTGATGAGGTTGCAGAGAAGTCGTTCGATCTGATTGTGTTGCCTGGAGGTCTTAAA
GGTGCTCCAAGATTGGCAAGCTGCGAGAAACTGGTGAATATGTTAAAGAAACAAGCGGAAGCGAACAAACCATATGGAGGAATCTG
CGCATCACCTGTTTACGTCTTTGAGCATCATGGTTTACTCAAGGGTAAGAAGGCAACTACCCACCCAGTGGTGAGCGACAAACTTT
CAGACCAGAGCCACGTTGAGCACAGAGTTGTTGTGGACGGCAATGTGATAACGAGCAGAGCTCCAGGGACTGCTATGGAGTTTGCA
CTTGCTATCGTTGAGAAGTTTTACGGGCGAGAGAAAGCGCTTCAGCTCGCCAAGGGAACACTTGTGTAAATTCTGAAGTATGAAAA
ATGTGGGGGGAGCAAGGGACGTTAATAAAAGGGCCTTTTTATTTATCTTTCTGTTGCTGATGATGAGTGGCTTTGTAATGTGAGCT
TTTGGCTGAATGGAATGTGGATTTTACGTCTTTAATAATTGAATAAATAAAGGTTATTCTAC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAP96742 ThiJ-like protein [Brassica rapa subsp. pekinensis]19128e-212
XP_002882906 hypothetical protein ARALYDRAFT_478924 [Arabidopsis lyrata subsp. lyrata]18662e-206
NP_188117 class I glutamine amidotransferase domain-containing protein [Arabidopsis thaliana]18383e-203
NP_850588 class I glutamine amidotransferase domain-containing protein [Arabidopsis thaliana]17353e-191
NP_564626 4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis [Arabidopsis thaliana]16341e-179

Swiss-Prot top hits (Blast detail)Scoree value
Q46948 Protein thiJ2976e-026
Q99LX0 Protein DJ-12852e-024
Q5XJ36 Protein DJ-12842e-024
P55880 Protein thiJ2842e-024
Q95LI9 Protein DJ-12806e-024

TrEMBL top hits (Blast detail)Scoree value
Q7XBC0 ThiJ-like protein19126e-212
Q9FPF0 AT3G14990 protein18382e-203
Q9LKA6 Emb|CAA17570.117352e-191
Q9MAH3 F12M16.1816341e-179
Q8LGH3 4-methyl-5(B-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative16241e-178

Arabidopsis top hits (Blast detail)Scoree value
AT3G14990.1 4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative18399e-206
AT3G14990.2 4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative17368e-194
AT3G14990.3 4-methyl-5(b-hydroxyethyl)-thiazole monophosphate biosynthesis protein, putative17368e-194
AT1G53280.1 DJ-1 family protein16354e-182
AT4G34020.1 DJ-1 family protein8236e-088

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
2116  44%
 
85  14%
 
62  6%
 
102  6%
 
122  6%
 
113  8%
 
204  11%
 
191  3%
 
181  3%

Unigene MembersMember information