Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19792

FASTA Sequence
Unigene ID: UN19792Length: 1423  SNP
GGACTCATCAGTCATCACAACATTCTCAAATCAGAGACCAAAAACGTCAAATCAAAACACAGAGTCATAATGGGATCTTTGGCTGA
AACACAGATTACTCCGGCTAAAATCTCCGACGAAGAAGCCAACCTCTTTGCTATGCAGCTCGCTGGTGCCACCGTGCTTCCGATGG
TTCTGACATCAGCCCTGGAGCTCGACCTGCTCGAGATCATATCCAAGAATGTCGCTCTCCCTGGCGGTCAACTGTCTCCCTCGGAG
GTAGCTTCTTATCTTTCGACCAAAAACCCTGATGCTCCAGTCATGGTTGACCGGATCCTTAGGTTGCTTGCGGCTTACTCCGTCTT
AACCTGCTCTGTCCGTAAGCTTCCCGATGGCGGCGTGGAACGTCTGTACGGACTTGGACCGGTATGCAAGTACCTTATTAAGAACG
AAGACGGAGTTGCACTCGATGCACTCTGTCATTTGAACAGAGACAGGGTCTTCATGGAGAGCTGGTATCATTTGAAAGATGCAGTT
CTTGAAGGTGGGATTCCATTCAACAGGGCATTTGGTATGGGCGCTTTCGAGTACCAAGGGTCTGATCCGAGGTTCAACAAGGTGTT
CAACAGTGGAATGTCCAACCACACGACGATAGTCATGACCAAGATTCTAGAGATATACAAAGGCTTTGAGGGATTATCTTCGTTGG
TTGATGTTGGTGGTGGCATTGGAGTTACTCTCCGTATGATTGTCTCCAAGCACCCATACATCAAGGGGATCCTCTATGATCTCCCT
CATGTCATCGAGGAAGCTATTTCCTATCCTGGTATTGAACACATTGGCGGAGATATGTTTGTGAATGTCCCTAAAGCAGATGCCAT
CTTCATGAAGTGGATATGTCATGATTGGAGTGACCAACACTGTTTGAAATTTCTCAAGAATTGTTATGAAGCACTCCCAGACAACG
GGAAAGTGATAGTGGCGGAATCAATGCTTCCGGTGTTGCCAGACTCAAGCCTCATGACGAAAGAAGTTGTCCACATGGACTGCCTC
ATGCTGGCTCACAACCCCGGAGGCAAAGAACGGACTGAGAAGGAGTTTGAAGCATTAGCCAGAGGTTCTGGCTTCCAAGGCTTTCA
AGTTGTCTGCAGAGCCTATGGTACTCACATCTTCGAGTTCCTCAAGAAGATATGAGCCTAATAAGTACAAATATCCATGGAACATT
TTCTTCTCGATTTTTTGCGTCCAGATATTTTTTCTACATTTCCAGTGTTATCCTGTTCTGCATATATGTTGTTTCTCTGGCTTGTG
AGGCCACTATCGTCGTTGTTTACTTGTTTAAGCTGTTTTTGATGTTGTTGGAAAATGCATTTCTTTGTAATTGTATTTCCGATTTT
AATGCATATGAATAAAACCAAGACCAAATAATATGTTAAATCAAAGC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002869540 hypothetical protein ARALYDRAFT_913747 [Arabidopsis lyrata subsp. lyrata]17632e-194
XP_002864309 O-methyltransferase 1 [Arabidopsis lyrata subsp. lyrata]14711e-160
ACT87981 caffeic acid O-methyltransferase [Jatropha curcas]14655e-160
NP_200227 Quercetin 3-O-methyltransferase 1 [Arabidopsis thaliana]14647e-160
XP_002525818 o-methyltransferase, putative [Ricinus communis]14602e-159

Swiss-Prot top hits (Blast detail)Scoree value
Q9FK25 Quercetin 3-O-methyltransferase 114643e-161
Q00763 Caffeic acid 3-O-methyltransferase 114501e-159
Q43046 Caffeic acid 3-O-methyltransferase 114464e-159
P28002 Caffeic acid 3-O-methyltransferase14455e-159
Q8GU25 Caffeic acid 3-O-methyltransferase14446e-159

TrEMBL top hits (Blast detail)Scoree value
C7F6Z3 Caffeic acid O-methyltransferase14654e-160
B9SIJ9 O-methyltransferase, putative14601e-159
C6TIJ7 Putative uncharacterized protein14582e-159
C6TGR0 Putative uncharacterized protein14502e-158
D0VDZ3 S-adenosyl-L-methionine: caffeic acid 3-0-methyltransferase14483e-158

Arabidopsis top hits (Blast detail)Scoree value
AT5G54160.1 ATOMT1 (O-METHYLTRANSFERASE 1); caffeate O-methyltransferase/ myricetin 3'-O-methyltransferase/ quercetin 3-O-methyltransferase14795e-164
AT1G77530.1 O-methyltransferase family 2 protein8164e-087
AT1G21130.1 O-methyltransferase, putative8065e-086
AT1G77520.1 O-methyltransferase family 2 protein8003e-085
AT1G33030.1 O-methyltransferase family 2 protein8003e-085

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
610  28%
 
89  25%
 
74  11%
 
122  6%
 
181  3%
 
96  17%
 
113  8%
 
101  3%

Unigene MembersMember information