Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19794

FASTA Sequence
Unigene ID: UN19794Length: 959  SNP
GGAGTTTCATTTTCAACACCAACGACGCGTTTCACTTGTTTCTCTCCCAAAGCTTTCTCCCTTTTTGATTCCAAGCAAGCAACGAT
GAGTGGAGAAACGAAAGAGAATCAGAAGCTGCAGCAGCGACCTGCTCCTCGTCTTAACGAGAGGATTCTCTCTTCCTTGTCTAGAC
GATCCGTTGCTGCTCATCCCTGGCACGATCTTGAGATTGGTCCTGGAGCTCCACAGATTTTCAATGTGGTGGTTGAGATCACAAAG
GGAAGCAAGGTCAAATATGAACTTGACAAAAAGACTGGACTCATCAAGGTTGATCGTATTCTCTACTCCTCAGTTGTTTACCCTCA
CAACTATGGTTTCGTTCCTCGCACCCTATGTGAAGACAATGACCCTATTGATGTTTTAGTCATCATGCAGGAACCTGTGCTTCCAG
GTTGTTTTCTGCGTGCTCGTGCTATTGGATTAATGCCTATGATTGACCAGGGTGAGAAAGATGACAAGATTATTGCAGTTTGTGTT
GATGATCCTGAGTACAAGCATTACACTGACATCAAAGAGCTTCCTCCTCACCGTCTCTCTGAGATCCGTCGTTTCTTTGAAGACTA
CAAGAAGAATGAGAACAAGGAAGTTGCAGTTAATGATTTTCTCCCATCTGAGAAAGCTATTGAAGCTATCCAGTACTCAATGGACC
TTTATGCTGAGTACATTCTCCATACCCTGAGACGTTGAAGCTTTCTCCTCTCAACATTTCTGCAACGTCTTGTTTCTGTTTCTTTC
TATGATGATTACTTTCTCTGAATTTTCTTGTTAAACTTTGAATTTGTCCTTGTGAACTCAATAATATTTTCTTCTAAATCATCTTT
GTTATGTCTTAGAAATTGGAATACCTTCAATAAAAGATTTTATTATTGTACACTAACTAAAAAACATAAGTATATATTAATATAAA
ACAAAGATTTGCT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_171613 inorganic pyrophosphatase [Arabidopsis thaliana]10739e-115
BAI52729 inorganic pyrophosphatase [Brassica rapa subsp. chinensis]10693e-114
XP_002320239 predicted protein [Populus trichocarpa]10164e-108
AAD46520 soluble inorganic pyrophosphatase [Populus tremula x Populus tremuloides]10155e-108
XP_002301451 predicted protein [Populus trichocarpa]10146e-108

Swiss-Prot top hits (Blast detail)Scoree value
Q43187 Soluble inorganic pyrophosphatase9651e-103
O48556 Soluble inorganic pyrophosphatase9221e-098
A2X8Q3 Soluble inorganic pyrophosphatase8961e-095
Q0DYB1 Soluble inorganic pyrophosphatase8961e-095
O23979 Soluble inorganic pyrophosphatase8512e-090

TrEMBL top hits (Blast detail)Scoree value
Q93V56 At1g01050/T25K16_510736e-115
D1MVT0 Inorganic pyrophosphatase10692e-114
A9PDZ2 Predicted protein10162e-108
Q6PW70 Soluble inorganic pyrophosphatase10153e-108
Q9SWI0 Soluble inorganic pyrophosphatase10153e-108

Arabidopsis top hits (Blast detail)Scoree value
AT1G01050.1 AtPPa1 (Arabidopsis thaliana pyrophosphorylase 1); inorganic diphosphatase10743e-117
AT4G01480.1 AtPPa5 (Arabidopsis thaliana pyrophosphorylase 5); inorganic diphosphatase/ pyrophosphatase10026e-109
AT2G46860.1 AtPPa3 (Arabidopsis thaliana pyrophosphorylase 3); inorganic diphosphatase/ pyrophosphatase9864e-107
AT3G53620.1 AtPPa4 (Arabidopsis thaliana pyrophosphorylase 4); inorganic diphosphatase9068e-098
AT2G18230.1 AtPPa2 (Arabidopsis thaliana pyrophosphorylase 2); inorganic diphosphatase/ pyrophosphatase8172e-087

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
83  15%
 
62  10%
 
114  20%
 
102  10%
 
122  10%
 
77  35%

Unigene MembersMember information