Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19820

FASTA Sequence
Unigene ID: UN19820Length: 1374  SNP
GGGATGGGGCCTTACGAACCATTCACAGATACTCACATAAGACCTTCTCTTCAGTTTGCTCAGAGAGTGAACCAACAAGCATGGCG
AAGATGATGATGATGCAACAGAGCCAGCCTTCTTTATCTCTACTTACTTCTTCTCTCTCTGACTTTAATGGCGCCAAGCTCAACCT
ACAAGTCCAGTACAAGAGGAAGGTTCAACAGCCAAAAGGAGCACTCTATGTATCAGCATCGAGCGAGAAGAAGATTCTTATAATGG
GTGGCACTCGGTTCATTGGTATCTTCTTATCCAGGCTCCTTGTTAAAGAGGGACATCAGGTTACATTGTTCACAAGAGGTAAATCT
CCTATTGCCAAACAATTGCCTGGCGAATCTGACCAAGACTTTGCTGATTTTTCTTCCAAGATTCTTCACTTGAAAGGAGACAGAAA
GGACTATGACTTTGTGAAGTCAAGTCTTTCAGCTGAAGGCTTCGATGTTGTTTATGATATCAACGGGAGGGAAGCTGAAGAAGTTG
AGCCCATATTAGATGCACTTCCTAAACTAGAACAGTACATCTACTGTTCTTCAGCTGGTGTTTACCTGAAATCTGATATCTTGCCA
CACTGTGAGGTGGATGCAGTTGACCCGAAGAGCAGGCACAAGGGGAAGCTGGAGACAGAGAGCTTACTGCAATCAAAAGGTGTAAA
CTGGACTTCTATACGTCCTGTCTACATCTACGGTCCATTGAACTACAACCCCGTCGAAGAATGGTTCTTCCACCGTCTCAAAGCTG
GTCGACCTATCCCAGTTCCAAACTCTGGGATCCAGATCTCACAACTCGGTCACGTTAAGGACTTGGCAACAGCCTTTCTCGCCGTG
CTTGGTAACGAGAAAGCAAGCAGAGAGATATTCAACATCTCAGGAGAGAAGTACGTCACCTTTGATGGCTTAGCAAGAGCTTGCGC
AAAGGCTGGTGGGTTTCCAGAGCCAGAGATTGTTCACTACAACCCTAAAGAGTTCGACTTTGGGAAGAAGAAGGCCTTCCCTTTCC
GTGACCAGCATTTCTTTGCCTCGGTGGAGAAAGCAAAGCATGTCTTGGGATGGAAACCAGAGTTCGACTTGGTGGATGGTCTCACT
GACTCGTACAACCTCGACTTCGGTCGTGGCACTTTCAGAAAAGAGGCGGATTTCACTACTGACGACATGATTCTAAGCAAGAAACT
TGTTCTTCAATAGAAAACATTATTGGCTTTTATATGGTTGTGTGATCTCAAACTGAACAAGATTCTCAAGTTTATCATCGTCTCAA
ATGTACTTTCTGTATGGATTGTGTTCGAGTTTTTTCTATAAAAAAAGAAAAGCGGCGCGGGGTCTAGCTCTTGAAGTTTTACTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAJ33886 unnamed protein product [Thellungiella halophila]19324e-214
NP_172405 RNA binding protein [Arabidopsis thaliana]19136e-212
AAM65150 putative RNA-binding protein [Arabidopsis thaliana]19101e-211
AAL32648 g5bf protein [Arabidopsis thaliana]19092e-211
CAA71589 g5bf [Arabidopsis thaliana]19073e-211

Swiss-Prot top hits (Blast detail)Scoree value
Q9SA52 Uncharacterized protein At1g09340, chloroplastic19132e-213
Q9LYA9 Uncharacterized protein At3g63140, chloroplastic5162e-051

TrEMBL top hits (Blast detail)Scoree value
B9RFM2 NAD dependent epimerase/dehydratase, putative17253e-190
A9PJN1 Putative uncharacterized protein17055e-188
B9I6P3 Predicted protein17002e-187
A5AIE0 Putative uncharacterized protein16993e-187
A9PGZ8 Putative uncharacterized protein16966e-187

Arabidopsis top hits (Blast detail)Scoree value
AT1G09340.1 CRB (CHLOROPLAST RNA BINDING); binding / catalytic/ coenzyme binding19142e-214
AT3G63140.1 CSP41A (CHLOROPLAST STEM-LOOP BINDING PROTEIN OF 41 KDA); mRNA binding / poly(U) binding5162e-052

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
118  24%
 
102  6%
 
88  24%
 
64  12%
 
211  3%
 
192  6%
 
96  18%
 
122  6%

Unigene MembersMember information