Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19832

FASTA Sequence
Unigene ID: UN19832Length: 1239 SSRSNP
CCTGACTCAATCCGGTAGGCATATATATATCAAACTCGGTTTAAACAAAACATAACCAATAAAACCGGATCACAATGATATAAGAA
GTCCAGACAGCTCTGTTCAAAAGTCTGATCCCACCATAAAGCACAAACAAACAAGTCTTTCATTTAACTTTTACACATTATTTTTA
AACATCAGAGATTCAGCCCTCATTCTCTTAACCTCTTTTCCTTATTCCTCATCATCATCATCATCTTCCTTCTTCAAACGAGTCTC
ACCACCTTCCTTGATAATAGGAAGCTTCATACCTCCAAACGGTGTATCAACATCCACATTACCTTTAATAGTGTACCCAGTTCCTT
TACCACGTATCATATCCCAAAGCGCAGACCCAAAGTCCTTTGGCTTGAACGTGATCGGCACATTAATCAACCCACTTCCGTTTTTA
TCAAGCTTTACAGAGTCAGATATCTCTGCTTTCCCAATACTCACATCAGCCAACCACACTTCACAGTCCAAGTCATTAACCCCCAA
ATCAAAATCATTCAAGTTCTCAAGCCTCACGTGGAGTATCGCCACGGTTTCTTCCAGAGAAAACTTCTGGAACTTGATCTTCTCGA
TGTCGACATCAGGTTTCTTCGGGATGGGAATCTCTCCACGTTTCTCCAACGGCAACGTGAGCCTCCCCAAGACAGGGACGTCGACG
ATGAGATCAACTTTGATCCTGTAAGGTATGATCATCCCGGGGTTGATGTCGTTGTAAGTGCTCTTGATGTCGTCGTAGATCAGAGT
CAGCGGTATCTTGACGGTTTCTTCTCCATGCGCCTTGATGGTTCCAGCGTCAGGGATCAGTCCAGAGACGAGTTTCCTCCCGTCAC
TGTCGATCAAGTAGTCGATGTCGATGAGAGGGATGGGAACAGGGTTGGGGTTCTTGACGAGCACGTCTACGACAATGTCTGCTCTC
TCGAGATTGATCTTGGGGATGTGAATGGCGGAGACGTCAGCTGTTGGCTTCCCGAAACCAACGGTTCCCTGTATCTTCCCGCCGAT
GTCGTGAATGAAACCTTTGACATTGTCTAGGAATCCACCTTTACCTTCTTCTTCTTTTTCATCCTCCTCCTTGTGAGCTCTGTCAA
CGATTTCAACTTTGTTCTCGGATGTAGACATACCTCGAGAGTTGGATGGAATGTGAGCAAGAGAGAGACAAGAGAGTGCTTTCAAG
AGTTGTGTGGTGGTGTTGGCTCAGGCTGATTCGTG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAM64433 similar to late embryogenesis abundant proteins [Arabidopsis thaliana]14753e-161
NP_181934 Late embryogenesis abundant protein, group 2 [Arabidopsis thaliana]14753e-161
XP_002880080 predicted protein [Arabidopsis lyrata subsp. lyrata]14701e-160
CBI24768 unnamed protein product [Vitis vinifera]12593e-136
XP_002533345 Late embryogenesis abundant protein Lea14-A, putative [Ricinus communis]12522e-135

Swiss-Prot top hits (Blast detail)Scoree value
O82355 Desiccation-related protein At2g461402017e-015

TrEMBL top hits (Blast detail)Scoree value
O80576 At2g4406014752e-161
Q8LCW6 Similar to late embryogenesis abundant proteins14752e-161
B9T526 Late embryogenesis abundant protein Lea14-A, putative12522e-135
A5B1L7 Putative uncharacterized protein12468e-135
A9PFS2 Putative uncharacterized protein12432e-134

Arabidopsis top hits (Blast detail)Scoree value
AT2G44060.1 late embryogenesis abundant family protein / LEA family protein14751e-163
AT2G44060.2 late embryogenesis abundant family protein / LEA family protein14751e-163
AT2G46140.1 late embryogenesis abundant protein, putative / LEA protein, putative2016e-016

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
1123  52%
 
126  14%
 
204  9%
 
64  9%
 
193  7%
 
212  5%
 
182  5%

Unigene MembersMember information