Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19833

FASTA Sequence
Unigene ID: UN19833Length: 1419  SNP
GGAAGAAACAAAACAAACAAATTAATAAAAAATAAATAGTAATATTAGTAGTAAATATTTTTTTATTAAACGATGGGTGCATATTC
TGGAGCTTTTACAATTTTTATTTTCTGTTTGTTGGGATTTTCAGCCAATGCTGTATACATCACCATTGGTTCCTCTTCAGGTTCTG
ATATTACTCAGGCACTTCTGAAAGCATTCACAACAGCATGCCAATCTCCCACACCGAGCAAAGTGGTGATCCCAAAAGGAGTGTTC
AAGCTTGGTGAGATCCAGATGAGGGGTCCATGCAAAGCCCCAATCGAGATCACCATTCAAGGCACTGTCAAAGCTGATGGTAACGC
GATCCAGGGGAAGGACACATGGGTTGTCTTCGGCAACATTAATGGATTTAAGTTGAACGGAGGTGGAGCTTTCGATGGTGAAGGAA
ACGCAGCTTGGAGGGTTAACAACTGTCACCAGACTTTCAACTGCAAGAAACTTCCTATCAGTATAAGATTTGATTTCGTGGAGAAC
GCTGAGATCAGAGACATATCTTCAATAGATGCCAAGAACTTCCACATCAACGTGCTTGGTGCCAAGAACATGACCTTTGATCACAT
CAACATCATTGCTCCAAAAGACAGTCCCAACACTGATGGTATCCATTTGGGAAGAAGTGACGGAGTCAAGATCCTTAACACATTCA
TCACCACCGGAGATGACTGCATCTCTGTTGGAGATGGGATGAGGAACCTCCACGTGGAGAAAGTCACGTGCGGTCCAGGACATGGA
ATCAGTGTCGGAAGCCTTGGAAGGTACGGAATGGAACAAGATGTCACCGGCATTAGAGTCATAAACTGCACTCTCCAAGAGACTAC
CAACGGACTGAGGATCAAGACATGGCCGTCTGCAGCTTGCTCCACCACTGCCTCCGATATTCATTTCGAGAATATCATTGTCAAGA
ACGTTTTAAACCCAATCCTCATCGACCAAGAGTACTGCCCTTGGAACCAATGCAACAAGCAGAAACCATCAACGATTAAGCTTGTG
AACATCAGCTTCAAGCAAATCAGAGGAACATCAGGGAACAAGGATGCAGTGAAGCTTTTGTGCAGCAGGGGATACCCATGCCAAAA
CGTCGAGATTGGAGACATCGATATCAAGTACAACGGAGCAGATGGTCCAGCGACTTTCCAGTGCTCAAACGTGAGCCCCAGACTCA
TGGGAACTCAGAACCCTAAAGCTTGCACTGGTCCAGTGACCAATTTACCCCAATAAGTAGAAGGCTCCAAAAAATATTAACCTAAA
AACACCCATTCATTATTTGTTTTGTTTCCTCTACACACAATTTAATTATATGGTCTATGATGTATGCTCTCATTCTTTTTGATTCC
AAAATAAATGCATTCATTATTCCTAGGGCTGTTCAATATGGGT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ABL63521 pollen-specific protein MF9l [Brassica oleracea var. alboglabra]20311e-225
ABG38468 pollen-expressed protein MF9c [Brassica oleracea]20221e-224
ABN13878 polygalacturonase [Brassica rapa subsp. campestris]20193e-224
XP_002884668 polygalacturonase 3 [Arabidopsis lyrata subsp. lyrata]18438e-204
NP_187439 polygalacturonase-like protein [Arabidopsis thaliana]18322e-202

Swiss-Prot top hits (Blast detail)Scoree value
P35337 Polygalacturonase16202e-179
Q39766 Polygalacturonase10575e-114
Q39786 Polygalacturonase10566e-114
Q05967 Polygalacturonase10064e-108
P24548 Exopolygalacturonase (Fragment)9894e-106

TrEMBL top hits (Blast detail)Scoree value
A1ECA6 Pollen-specific protein MF9l20319e-226
Q0Z964 Pollen-expressed protein MF9c20221e-224
B3EZF0 Polygalacturonase20192e-224
Q9SFD2 Polygalacturonase (PGA3)18321e-202
O65905 Polygalacturonase18311e-202

Arabidopsis top hits (Blast detail)Scoree value
AT3G07820.1 polygalacturonase 3 (PGA3) / pectinase18326e-205
AT3G07840.1 polygalacturonase, putative / pectinase, putative16856e-188
AT3G07830.1 polygalacturonase, putative / pectinase, putative16767e-187
AT5G48140.1 polygalacturonase, putative / pectinase, putative16632e-185
AT3G07850.1 exopolygalacturonase / galacturan 1,4-alpha-galacturonidase / pectinase8882e-095

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
69  27%
 
124  12%
 
92  6%
 
102  6%
 
1110  30%
 
73  9%
 
83  9%

Unigene MembersMember information