Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19857

FASTA Sequence
Unigene ID: UN19857Length: 1381 SSR 
GGAGAGAGAGAGAGAGAGAGAGAGAGAGAGATGCGGTTCGAACAAAAAACGGCAAAAAAGGTTTAGAGGTTACCTTTTTCACTCTT
TAGCGTGAAGGAAGGATATCAGTGAAGAAGATTTTCTTTTATTTTATTTTACAAAAAAGGGACTGAGAGAATAAGAAGGGTAGAGG
AGATCTTGTTTTTTGATTCTGGTAAAATATCGATGGCGACGAAGCATCCTTGTTTTGAGCTCGCCAAAGGTATCAATGGCCTCGAC
AAAATCGTCCTCCGCGAGTCTCGTAACCGCTCCGCCGAGGTATACTTGTATGGTGGTCATGTGACTTCTTGGAAGAATGAAAACGG
AGAAGAGTTACTTTACCTCAGCAGCAAGGCTATATTCAAGCCTCCTAAACCAATCCGTGGAGGGATTCCTCTTTGCTTTCCTCAAT
TCAGTAACCTTGGTACACTCGAATCACATGGATTCGCTAGAAACAGGATCTGGGAAGTTGATGCTACCCCACCTCCTTTGCCTACG
AACTCTTCTTCTAATGCTTTCGTTGACCTCATCCTCAGGCCAACTGAAGACGATCTTAAGACATGGCCTTACAATTTTGAGTTCCG
GATGAGGGTGAACTTGGGATCTGAAGGAGAATTGACACTGACATCTCGTATCAGGAACACCAACGCTGATGGAAAGCCGTTTACAT
TCACATTTGCTTATCACACCTATTTCTCCGTCTCGGACATCAGTGAAGTAAGGGTTGAAGGGTTGGAGACGCTGGATTATCTAGAC
AACTTAAAGAACAGAGAACGTTTTACGGAGCAAGGTGATGCTATTACTTTTGAATCCGAAATTGACAAGATTTACCTAAGCACTCC
TACAAAGATTGCTATTTTGGACCACGAGAAAAAGAGGACTTTCGTTGTACGCAAGGACGGGCTTGCTGATGCAGTGGTGTGGAATC
CTTGGGATAAGAAGTCAAAGTCGATATCGGACTTGGGAGATGAAGACTATAAGCATATGTTATGTGTTGAAGCTGCAGCTGTGGAA
AGACCGATCACATTAAAACCAGGTGAAGAATGGAAAGGAAGACTCGAGCTCTCTGCGGTTCCATCTAGTTACTCCAGTGGACAGCT
TGACCCCAAGAAAGTCCTCCAATGAATCTTTCAAACTTCAAAAAAATATCACCTTTTCTCCTCTCTTTTTCTTATTTGATTGCAGG
TAGCTTCAAAATATATACTCTTTCCTGTTTTATATCTGTTTCATGAACACTTGTGTGTGTTCCAAACGTCAAAACATACAAAATCT
TTTCGTTTATATTGGTAAAACATGATAGGGGGTCTTTCCTTTGATTTAGATACTTTGTTATTTTGTTATGAGAAATATTTTGATTT
TGTGG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_200543 glucose-6-phosphate 1-epimerase [Arabidopsis thaliana]15202e-166
XP_002864512 aldose 1-epimerase family protein [Arabidopsis lyrata subsp. lyrata]15158e-166
ACU18143 unknown [Glycine max]13501e-146
XP_002268176 PREDICTED: hypothetical protein [Vitis vinifera]13454e-146
XP_002324462 predicted protein [Populus trichocarpa]13259e-144

Swiss-Prot top hits (Blast detail)Scoree value
Q40784 Putative glucose-6-phosphate 1-epimerase12483e-136
Q03161 Glucose-6-phosphate 1-epimerase3381e-030
P39173 Putative glucose-6-phosphate 1-epimerase1686e-011
P44160 Putative glucose-6-phosphate 1-epimerase1533e-009

TrEMBL top hits (Blast detail)Scoree value
Q9LVC5 Apospory-associated protein C15202e-166
C6T8J1 Putative uncharacterized protein13508e-147
A2Q396 Galactose mutarotase-like13311e-144
B9N327 Predicted protein13274e-144
B9ILW3 Predicted protein13256e-144

Arabidopsis top hits (Blast detail)Scoree value
AT5G57330.1 aldose 1-epimerase family protein15216e-169
AT3G61610.1 aldose 1-epimerase family protein10673e-116
AT3G01590.2 aldose 1-epimerase family protein10101e-109
AT3G01590.1 aldose 1-epimerase family protein10101e-109
AT4G25900.1 aldose 1-epimerase family protein10054e-109

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
62  22%
 
81  11%
 
201  11%
 
121  11%
 
182  22%
 
112  22%

Unigene MembersMember information