Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19898

FASTA Sequence
Unigene ID: UN19898Length: 1474  SNP
ACAGATTCGCAGCGAAAAATCAGCGGTGGGGGAAAATGGCTCTATCACGCCGCCTAACATCGCGATCTACCCTCATCTCCCATCCC
CTCTCCGCCGCCTTCAACCGTTTCATCTCAACCGACACCACACCCATCACAATCGAGACCTCCCTCCCTTTCACCGCCCACCTATG
CGACCCTCCCTCCCGCTCCGTCGAATCCTCCACCCAAGAGCTCCTCTCCTTCTTCCGCACCATGGCCCTGATGCGCCGCATGGAGA
TCGCGGCCGATTCGCTCTACAAGGCGAAGCTGATCCGAGGCTTCTGCCACCTGTACGACGGCCAGGAGGCCGTGGCCATCGGGATG
GAGGCGGCGATCACGAAGAAGGACGCCATCATCACGGCGTACCGCGACCACTGCATCTTCTTAGGGCGAGGGGGTTCGCTGTACGA
GGTGTTCGCTGAGCTGATGGGGAGGCGGGACGGGTGCTCGAGAGGGAAAGGGGGATCGATGCATTTCTATAAGAAGGATTCGTCGT
TTTACGGAGGGCATGGGATCGTTGGTGCTCAGGTTCCGTTAGGGTGTGGGATTGCTTTCGCGCAGAAGTATGGGAAGGAGGAGGCT
GTGACTTTTGCTATGTATGGTGATGGTGCTGCCAATCAGGGGCAGCTTTTTGAGGCTTTGAATATCTCTGCTCTTTGGGATTTGCC
TTCCATTCTCGTCTGCGAGAACAATCACTATGGGATGGGAACTGCTGAGTGGAGAGCTGCCAAGAGCCCATCTTACTACAAGCGTG
GTGATTACGTTCCTGGTTTGAAGGTAGATGGTATGGATGCATTTGCTGTCAAACAAGCGTGCAAATTTGCTAAGGAACATGCTTTG
AAGAATGGACCAATAATTCTGGAGATGGACACATACAGGTACCACGGTCACTCCATGTCTGACCCTGGGAGCACATACCGTACAAG
AGATGAGATATCTGGCGTGAGACAGGAACGAGATCCAATTGAGAGGATAAAGAAGCTGGTGCTATCTCATGACCTAGCAACCGAGA
AGGAGCTTAAGGATATGGAGAAGGAAATTAGAAAAGAAGTAGATGACGCCATTGCCAAAGCTAAGGATTGCCCAATGCCAGAGCCT
TCTGAGCTTTTCACCAATGTGTACGTGAAGGGATTTGGCACTGAGTCATTTGGAGCTGACAGAAAAGAAGTCAAAGCCGCGCTTCC
ATGAAGCTCTTGTTCGTTAAACTGCCACGTGGCATGACCAAGTTCTTTGATAGGAAGCCATGAAATAATAAAGAGGCTTTTTGGGC
AGAGTGTTGTGTGCTCTGTTCAAGGCCGTTGCGCGTTTTATTGTCCAAGTATCCTTTTCTTAGAGAGAAACATATGACTTTTGTGT
TTTGTATCTAAGTTTGCTTCTGATTGTTTTCAATACAGATGAACAGTTTCCGATTGTTCTATATTCATATTCAAGCACTTGGCTTT
GATCTTATTACT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
ABV89625 pyruvate dehydrogenase complex E1 alpha subunit dehydrogenase [Brassica rapa]19711e-218
NP_176198 pyruvate dehydrogenase complex E1 alpha subunit [Arabidopsis thaliana]19092e-211
AAK26016 putative pyruvate dehydrogenase e1 alpha subunit [Arabidopsis thaliana]19064e-211
AAA86507 pyruvate dehydrogenase E1 alpha subunit [Arabidopsis thaliana]19012e-210
XP_002888164 AT-E1 alpha [Arabidopsis lyrata subsp. lyrata]19012e-210

Swiss-Prot top hits (Blast detail)Scoree value
P52901 Pyruvate dehydrogenase E1 component subunit alpha-1, mitochondrial19098e-213
P52902 Pyruvate dehydrogenase E1 component subunit alpha, mitochondrial17271e-191
Q8H1Y0 Pyruvate dehydrogenase E1 component subunit alpha-2, mitochondrial17036e-189
P52903 Pyruvate dehydrogenase E1 component subunit alpha, mitochondrial16732e-185
Q54C70 Pyruvate dehydrogenase E1 component subunit alpha, mitochondrial10352e-111

TrEMBL top hits (Blast detail)Scoree value
A8IXJ9 Pyruvate dehydrogenase complex E1 alpha subunit dehydrogenase19718e-219
Q4JIY3 Pyruvate dehydrogenase (Fragment)17451e-192
D2D323 Pyruvate dehydrogenase alpha subunit17423e-192
B9HLV5 Predicted protein17307e-191
B9HU92 Predicted protein17201e-189

Arabidopsis top hits (Blast detail)Scoree value
AT1G59900.1 AT-E1 ALPHA; oxidoreductase, acting on the aldehyde or oxo group of donors, disulfide as acceptor / pyruvate dehydrogenase (acetyl-transferring)19105e-214
AT1G24180.1 IAR4; oxidoreductase, acting on the aldehyde or oxo group of donors, disulfide as acceptor / pyruvate dehydrogenase (acetyl-transferring)17044e-190
AT1G01090.1 PDH-E1 ALPHA (PYRUVATE DEHYDROGENASE E1 ALPHA); pyruvate dehydrogenase (acetyl-transferring)6103e-063
AT5G09300.1 2-oxoisovalerate dehydrogenase, putative / 3-methyl-2-oxobutanoate dehydrogenase, putative / branched-chain alpha-keto acid dehydrogenase E1 alpha subunit, putative3631e-034
AT5G09300.2 2-oxoisovalerate dehydrogenase, putative / 3-methyl-2-oxobutanoate dehydrogenase, putative / branched-chain alpha-keto acid dehydrogenase E1 alpha subunit, putative3631e-034

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
186  17%
 
218  22%
 
118  22%
 
73  8%
 
129  25%
 
92  6%

Unigene MembersMember information