Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19915

FASTA Sequence
Unigene ID: UN19915Length: 1598 SSRSNP
TATGACTTTTGTCGAAAATTATTAAAACAGGACTGCCCATTGTCGCAAGAAAACAGTACAGAAACAATAAACAGAAACATAATGGT
CAAACGGGAAACATTTCAGTTAACACCTCTAGTTACTCCTTCAAGAAGGACACTCAACAACTGTCACGCCAGAGAAAAAACAAAAC
AAGAGTTGTAGAGAGAATCTGAGACAAGAGCTAATACACATCCACTTCAATAACTCAATTCACCATTTACAAACGGTGGTTCATCA
TCACAGACAGCTTTCTGGAACTTCAGCTCCGATCACGACACACACACATCATGCTTCACTGCTGTTGGTGCTGGTAGCCACCAGGC
TGCTGGTAGTTTCCATAGCCGGCACCAGGATAGCCACCATAGTAGGCGTTAGGGTCCTGAGGAGGAGGCGCATATCCGTAAGCTTC
ATATCCCTGAGGAGGATACCCATAGTATCCACCACCACCACCATACTGAGATTGATCAGGTTGAGTCTGCTTGTTGGAAGGAGTGC
GACCCCATGAAAGACGAATGCTTTGTCCGCCAAGCTGTGTTCCATTCAACGAGTTGAGTGCTTGCTCTGCACATCCCCTATTAGCA
AACTGAACAAATCCGCAACGTTTTCCTGCAGGTATTTTTACATGAACAAGTTCACCAAATTGACCAAAAACTGACTTCAAAACATC
TTCTGTCACACTTTCATCCAAAGCTCCAACAAAAATCGTTGTGTTAGTTGGATCACCTTCTCCGGGATTTCCTTGAGTGTTCTGAT
ATCCACCTGGTTGTTGTTGCATTGTAAGAGGCTTCTTGTTAGCAGCCGGACCAATACGCATAGGCCTGGACGAGCAGTACTGACCA
TTCATCTCAGTCATGGCACGCATCTGCTCACTCTCATCCCCAAACTTCACAAACCCGTATCCCTTGGACCTCCCAGTGGTCCTATC
GGTCACAACTTTAGCTCCCTTAACAGATGAATACACAGACTTGAACGTCTCGGTGAGCACGTAGTCAGTAACATCAGGCGCCAGGT
CTCCAACGAAAACAGTGTGCTCAGGCCCGTCGGACTGGCGTCTCTCCCCAGCACCGAGCTGAGCCCAGTTCAGCCTGAAGGTCTGC
TCACAGTTAGGCATCTGAGCACCGTTGTAAGTCTGCAGAATCCTCTCAGCCGCAGCGTGGCTCACAAACTCGATGAAACCGTACCC
TTCGGTTAACCCGGTCTGCTTATTGCGAATGACTTTAGCTTGTTGGACCTCGCCGGTGATGGAGAAGATGCTGATGAGGTAGCCTT
CGTCCATCCATGGCTGAAGGTCTCCGATCCACAAGGATTTGATCTCTCCAGCTGATCCTGGATTCTGAGATCCGCCGCCGTAGTGA
TGTTGACCGGCTGGAGATGGCGCCGACTGTTGTAAATTCCATCCTGCTGGTGGCTGACCTTGTTGTTGCTGCTGCATCATCCACGG
CTGCTGGTGGTGGTGGTAAGCTTGCTGGTCGGAAGGGATATGTCCTGATCCTGCGGCGGCACCGTTTGCGGCGGGAGGTGGTTGCT
GCATCATGACGGCGAAGACCTAGAAAAACAAGAGAGACGATGCCGAAGTG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002867529 hypothetical protein ARALYDRAFT_913848 [Arabidopsis lyrata subsp. lyrata]18814e-208
CAB36546 putative DNA binding protein [Arabidopsis thaliana]18761e-207
NP_567764 RNA recognition motif-containing protein [Arabidopsis thaliana]18761e-207
XP_002316998 predicted protein [Populus trichocarpa]15095e-165
XP_002522953 nuclear acid binding protein, putative [Ricinus communis]14702e-160

Swiss-Prot top hits (Blast detail)Scoree value
O60176 Uncharacterized RNA-binding protein C23E6.01c5997e-061
O13759 RNA-binding post-transcriptional regulator csx13622e-033
Q00539 Protein NAM82412e-019
P32831 Negative growth regulatory protein NGR12403e-019
Q15427 Splicing factor 3B subunit 42011e-014

TrEMBL top hits (Blast detail)Scoree value
Q93W34 Putative DNA binding protein18761e-207
Q9SZ39 Putative DNA binding protein18761e-207
B9I0E1 Predicted protein15093e-165
B9SAD4 Nuclear acid binding protein, putative14701e-160
A5C5B3 Putative uncharacterized protein13723e-149

Arabidopsis top hits (Blast detail)Scoree value
AT4G27000.1 ATRBP45C; RNA binding18774e-210
AT5G54900.1 ATRBP45A (RNA-binding protein 45A); RNA binding14008e-155
AT1G11650.2 RNA-binding protein 45 (RBP45), putative11462e-125
AT5G19350.2 RNA-binding protein 45 (RBP45), putative9383e-101
AT5G19350.1 RNA-binding protein 45 (RBP45), putative9365e-101

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
118  32%
 
206  24%
 
61  4%
 
215  20%
 
191  4%
 
184  16%

Unigene MembersMember information