Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19948

FASTA Sequence
Unigene ID: UN19948Length: 1314 SSRSNP
GCATTAAGAAGTAAATATAATAAACATGAAGCATTTAAGCCTTTGTAGTTTATACAGAACAAAATCTATCAAAGGATTTGGCTAAA
GATCTGAATAAACAGATTCATAACCGAGCAAAATATTTTGAAACAAAGGTTTCACATAACCAGAGACGATAACTAAACATCTGGTT
TATTTTTCTAAATCAAAGGAAACGCCAATGGCTAAGGATAATACATCAGGGAATAAGTTATTCAAGGCTCGATCTTGATGCCGTTT
TGGCTTGATTCTTGTGATGTCGAAGGAGGAGGAGGAGGAGGAAGATGACCTTTCTCTTGCAAGCTCTTGACAGTGTCGTAAAGGCT
TTGCTTGGTGGACGTGAACTCTAAGCCTAAGTCCTTTATCTTTTGGTTAGTGAACTTGTACGGCTTGGCTCTTGGGTTCTTCTCGT
CCTTGCACTTGGTTGGAAGTGGGTACTCCGGGAATAACTTAGCCAAAATCTCAACAACTTCGCCGCGGTGAAGTGCGCTCTCCGCA
AGGAGATAACGTCCAGAGGCCGAGGGTGCCTCGTAGACAAGAACATGAGCTAGTGCGACATCACGAACATCCACATAAGCCTGAGT
CAAATTAGCGTAAGTCTTAGCCGAGCCGGTTAGATACTTTAGTACGTGGAAGAGACTGGCGTTGATCGTCGGCTGTAACGGCGGAC
CAAGAACCAGCACCGGATTCAAAACCACCAGGTCAACACCTTTCTCCTCTGCCGTCTCCCACGCCGCTTGCTCCGCCACCATCTTG
CCGTAACAATACCAATTCTTAGTGTTTTTGCAGAACTCAAGATCACTCCAACAACTTTCGTCAACAACGGCTTCAGGGTCACGGTT
CGGGTCCATGTAGACCGCACCAATTGAGGAGGTGATGACCACGCGCTTCACCTTGGTTTCAGCTGCAGCATTAATTACGAACTTGG
CTCCGTTCACGGCCGGCTCCACCATTTCTTCGGGATCGTCAGTGACCGGAGAAGCCGTGTGAAAGACGCCATCGCAACCATCGATA
GCCTCCTTAAGAGCATCATAGTCCTGGAGATCTGCTTTGCACAGAATCAGTCTCTCCTTGGCCCCTTCTAGTTCTCTCAAATGTGT
GTTCTTCGGATCATCTGGATTCCGTACGGTTCCTTTGACCGTGTAGCCTCTCTCAAGGAGTAACTTAATAATCCAAGAAGCGATGT
ATCCACCAGCACCAGTGACGCAGACTGTTTTCCCGGGCGTAATTAAAGATTCGTCAACTGGCATCGTTTCCGGCAGTAGAAAACAA
AAGCTTCGGTCTTGAAGAGACAGA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_173047 cinnamoyl coa reductase 1 [Arabidopsis thaliana]16734e-184
XP_002890139 hypothetical protein ARALYDRAFT_471794 [Arabidopsis lyrata subsp. lyrata]16672e-183
AAG46037 cinnamoyl CoA reductase isoform 1 [Arabidopsis thaliana]16635e-183
ADC40029 cinnamoyl-CoA reductase [Isatis tinctoria]16627e-183
NP_001077544 cinnamoyl coa reductase 1 [Arabidopsis thaliana]15462e-169

Swiss-Prot top hits (Blast detail)Scoree value
P51104 Dihydroflavonol-4-reductase6122e-062
Q9XES5 Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase5915e-060
Q84KP0 Bifunctional dihydroflavonol 4-reductase/flavanone 4-reductase5825e-059
P51103 Dihydroflavonol-4-reductase5432e-054
P51110 Dihydroflavonol-4-reductase5432e-054

TrEMBL top hits (Blast detail)Scoree value
Q9S9N9 Cinnamoyl CoA reductase 116733e-184
Q9FPM0 Cinnamoyl CoA reductase isoform 116634e-183
D3J7Z3 Cinnamoyl-CoA reductase16625e-183
A8MQW5 Uncharacterized protein At1g15950.215461e-169
C0Z2K0 AT1G15950 protein15399e-169

Arabidopsis top hits (Blast detail)Scoree value
AT1G15950.1 CCR1 (CINNAMOYL COA REDUCTASE 1); cinnamoyl-CoA reductase16731e-186
AT1G15950.2 CCR1 (CINNAMOYL COA REDUCTASE 1); cinnamoyl-CoA reductase15467e-172
AT1G80820.1 CCR2 (CINNAMOYL COA REDUCTASE); cinnamoyl-CoA reductase14382e-159
AT5G19440.1 cinnamyl-alcohol dehydrogenase, putative (CAD)8092e-086
AT1G51410.1 cinnamyl-alcohol dehydrogenase, putative (CAD)7545e-080

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
75  28%
 
83  17%
 
101  6%
 
63  17%
 
113  17%
 
201  6%
 
191  6%
 
211  6%

Unigene MembersMember information