Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN19957

FASTA Sequence
Unigene ID: UN19957Length: 1191 SSRSNP
GGGGAACTTGTTGTGTTAAATCATCTCTCTCAACAAAACAGAGAGAAAATCACTATAAATCTTTAATTTTATTTGAAAAACCAATG
GCGGATCGGATTAAAGGTCCATGGAGTCCTGAAGAAGACGAGCAGCTTCGTAGGCTCGTTGTTAAATACGGTCCGAGAAACTGGAC
AGTGATTAGCAAATCAATCCCCGGTAGATCGGGAAAGTCGTGTCGGTTACGGTGGTGCAACCAGCTTTCGCCGCAGGTCGAGCACC
GGCCGTTCTCGGCGGAGGAAGACGAGACGATCGCGCGCGCGCACGCTCAGTTCGGTAACAAATGGGCCACGATAGCCCGTCTCCTC
AACGGCCGTACGGACAACGCCGTGAAGAATCACTGGAACTCGACGCTCAAGAGGAAATGCGGTGGTTTCGACCACCGTTACGGGGC
TCCGGCGGAGGAGGAGGAGGAGGAGGATCGAAGGCCGGCGAAGAGATCGGTGAGCGACGGATGTCCACCAGTTGCTACTGGGCTTT
ATATGAGCCCAGGAAGCCCAACTGGATCTGATGTCAGCGATTCGAGTACGATACCGGTTCTGCACTCTGTTGGGCTTTTCAGGCCC
GTTCCACGTGCGGGTGGTGTCGCGCTGCCGCTTCCCATCGAAACGTCGTCGTCTTCTGGTGACCCCGCGACTTCGCTGAGCTTGTC
GCTTCCTGGTGCTGACGTCAGCGAGGAGTCAAACCGTAGTCACGAGTCAACTAATATCAACAACACTTGGAGCCGACAGAACAAAA
AAACAGAGTCGCTGTTACCATTTTCTGTCGGATTCCGAGGTGCGATTGAGGAAATGGGGAAGTCGTTTGCTGGGAACGGCGGGGAG
TTTATGGCGATGGTGCAGGAGATGATAAAGGCGGAGGTGAGGAGTTACATGATGGAGATGCAGAGAAACCATAATGGGATGATTCC
GATGAGTCAAATTGGAGTCGGGAGAATCGAGTAGAAAAGGGAGAGTTTAGTAACTGTTACAATCAATATGTGAAACCAACCGCTAT
GGAAATCTGGAGGAAGAGAAGAAAAAACTCTCTGTTTCTCTTTCTCATTTCGGATTAGACATTTAAGAATTTTGGGACTTAAGAAA
TGTATAGAGCGGAAGTCGAATGAGCAAAATCTCGGTTCGTGAACCTAGAGTAATAAATAAAATTTTCAATCTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_201531 transcription factor MYB44 [Arabidopsis thaliana]13033e-141
XP_002866710 AtMYB44/AtMYBr1 [Arabidopsis lyrata subsp. lyrata]13023e-141
AAK96490 AT5g67300/K8K14_2 [Arabidopsis thaliana]13006e-141
CAA90809 MYB-related protein [Arabidopsis thaliana]12971e-140
AAM64847 myb-related protein, 33.3K [Arabidopsis thaliana]12881e-139

Swiss-Prot top hits (Blast detail)Scoree value
Q9FDW1 Transcription factor MYB4413031e-142
P52551 Myb-related protein B3612e-033
Q54HP1 Myb-like protein Q3513e-032
Q08759 Transcriptional activator Myb3486e-032
Q03237 Myb-related protein B3442e-031

TrEMBL top hits (Blast detail)Scoree value
O49745 R2R3-MYB transcription factor8651e-090
Q39155 MYB-related protein8641e-090
Q9SN12 AT3g50060/F3A4_1408587e-090
A5HLW5 Putative R2R3-Myb transcription factor7923e-082
A5HLW6 Putative R2R3-Myb transcription factor7889e-082

Arabidopsis top hits (Blast detail)Scoree value
AT5G67300.1 MYBR1 (MYB DOMAIN PROTEIN R1); DNA binding / transcription factor13048e-144
AT3G50060.1 MYB77; DNA binding / transcription factor8584e-092
AT4G37260.1 MYB73 (MYB DOMAIN PROTEIN 73); DNA binding / transcription factor7374e-078
AT2G23290.1 AtMYB70 (myb domain protein 70); DNA binding / transcription factor5171e-052
AT3G55730.1 MYB109 (myb domain protein 109); DNA binding / transcription factor4061e-039

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
104  24%
 
94  24%
 
82  12%
 
202  12%
 
181  6%
 
112  12%
 
191  6%
 
71  6%

Unigene MembersMember information