Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN20002

FASTA Sequence
Unigene ID: UN20002Length: 892  SNP
GGACTCGACCTAAAGCTTAAACCCTAGCAACCGCGTAGAAAGAAGAGAAAAGGCGAAAGCTTCTCACAAGGTTAGTAACAATGGCT
GAGCAACAAGAGATCCTCGATTCAGTGTCGGCAGCCGAAGTGAAACCAGATCCAATAACGGACACTGAAGTCGAAGAAGCTGCAGA
GAAACGCGGGAGAGAGGAGACGACGGAGGAAACAGAGGATGGAGGCGAATCCAAGAAGCAGAAAGTGGGAGAGGAAGAGAAACCCA
ACGGGTCGGATCCGGTCAAGCTGGGTCCGAAGGAGTTCGTCACCTCTGTGGCGATGTTTGATTACTTCACCAAGTTCATGCATTTC
TGGCCGACAGATCTCGATGTCAACAAGTATGAACACATGGTGCTGTTAGATCTGATCAAGAAGGGCCATACTGAGCCTGACAATAA
GATTGGGGGAGGGATCAAAGGCTTCCAAGTGAGAACCCACCCGATGTGGAAAAGCAGGTGCTTCTTTCTGGTTAGGGAAGACGACA
CTGCTGACGATTTCAGCTACAGGAAGTGCGTTGATCACATCCTACCTTTGCCTGAAAACATGAAGACTCCTGGGTCTAACGGTAAT
GGACATGGTGGTGGTAGAAGAGGTGGCCGCGGTGGTGGCAGGGGTGGGAGATTCAGAAGATGAATTGACCCTTTTGTTGCTTTGTC
GAAATTTTGGAGCTTTTAATGTTAACTTCTGTTTGCTAAAAAACTTATTTAAGTTATGATCTTGTTGAATGCTGTTGTTATTTTCC
GGAGAATGTTTGTCACTTTATTGTTCAAGAACCGGAAGCTACAGCTCGTCTCTATGTTCACAACTTGAGAGTATACTTGAATTTGG
GCCTTTTGCTAAACGAACGTTTCAATCTTGAG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002866491 hypothetical protein ARALYDRAFT_496421 [Arabidopsis lyrata subsp. lyrata]8292e-086
NP_201050 uncharacterized protein [Arabidopsis thaliana]8273e-086
XP_002514753 conserved hypothetical protein [Ricinus communis]5342e-052
XP_002319542 predicted protein [Populus trichocarpa]5281e-051
XP_002328442 predicted protein [Populus trichocarpa]5137e-050

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q8L557 EMB5148272e-086
B9RLY4 Putative uncharacterized protein5342e-052
B9I7T1 Predicted protein5288e-052
B9MZV4 Predicted protein5135e-050
C6SWI8 Putative uncharacterized protein5082e-049

Arabidopsis top hits (Blast detail)Scoree value
AT5G62440.1 Encodes a protein DOMINO1 that belongs to a plant-specific gene family sharing a common motif present in the tomato DEFECTIVE CHLOROPLASTS AND LEAVES (LeDCL) protein. DOMINO1 is located in the nucleus. Arabidopsis embryos carrying the domino1 mutation grow slowly in comparison with wild type embryos and reach only the globular stage at desiccation. The primary defect of the mutation at the cellular level is the large size of the nucleolus that can be observed soon after fertilization in the nuclei of both the embryo and the endosperm. DOMINO1 might have a role in ribosome biogenesis and in determining the rate of cell division.8288e-089
AT1G45230.1 defective chloroplasts and leaves protein-related / DCL protein-related1253e-007
AT1G45230.2 defective chloroplasts and leaves protein-related / DCL protein-related1243e-007

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
96  27%
 
106  27%
 
113  14%
 
127  32%

Unigene MembersMember information