Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN20026

FASTA Sequence
Unigene ID: UN20026Length: 1068  SNP
TTTCCACGTCCCTTCTTCCCAACGAAACTGAGTTTCTATATAGATTAATAATCTATGAGATCTTCTTTCCTTTGGTAGAAAGCAAA
AGCAATGAATAATCTGCCAGAGGACTGCATCGCTAAGATCCTTTCCTTGACTACGCCTCGAGACGTTTGCCGATCATCGGCTGTCT
CCAGGTGTTTCAGATCCGCCGCTGACACCGACCATGTCTGGAATCACTTCTTACCTTCCGAGTTCCCCGAGGGTTTTAGGGCACCT
GAGGGTCTTCCCACCAAGAAACACCTCTTCTTCTCCCTCGTCCATAACCCTCTCCTTCTCCACGGTTCCCAATTGAGCTTTTCGCT
GGAGAGAAGTACTGGTAACAAGTGCTACATGATGGCTGCTAGGGCCTTGAATATTACTTGGGGACATGATCAAAGATACTGGCAGT
GGATCTCTCTTCCTGATGCCAGGTTCAAAGAAGTGGCTGCGCTTAAAATGGTATGGTGGCTTGACATCACTGGAAAAATCAACATA
AACCTTCTCTCTGATGACACCCTCTACGCCGCTTACCTTGTCTTTAAGTGGAACCTTGATCCCTACGGTTTTCGCCAGCCCGTAGA
GGCATCCCTTATTTTGGCTGGCACCGAGCATGATGATGTCCAGCCTTCCATGGTCAGTCTCATGCAGAATCCGGGAAGCGAACAAG
GTCAGCGCGCTGAGCTGAGAAGTGACGACTGGTACGAGGTGGAGTTGGGACAGTTCTTCAAAAGGAGAGGAGATATGGGTGAAATA
GAGATGAGCCTCAAGGAGACAAAGAGGCCTTTTGAGAAGAAAGGTCTTATCGTCCATGGAATTGAGATTAGGCCAGTACTGCCCTA
ATTTTATCCTACTGCTAATAACACCTTTTGCTCTTTGCAATTGTTGTTCTCAGTGTTGTGTTATCTTCTTCTCTTCTTATTTTCCC
CTGCTTCTTTGTTTTTTTTCTTCCTATATTGATGCAGAAAAAAATTGTATTTCAGTTTGATGGTTGCTTTGTTATTCAGAATAATT
ATTGACTACTACCGTGAAGCTTTTTCCAGATTAGGA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_565229 F-box protein PP2-B11 [Arabidopsis thaliana]10622e-113
XP_002889310 hypothetical protein ARALYDRAFT_895986 [Arabidopsis lyrata subsp. lyrata]10622e-113
AAD55487 Hypothetical protein [Arabidopsis thaliana]8264e-086
XP_002270580 PREDICTED: hypothetical protein [Vitis vinifera]5192e-050
CBI38323 unnamed protein product [Vitis vinifera]5192e-050

Swiss-Prot top hits (Blast detail)Scoree value
Q949S5 F-box protein PP2-B1110628e-115
Q3E6P4 F-box protein At2g022404992e-049
Q9ZVQ6 F-box protein PP2-B104964e-049
Q9ZVR5 Putative F-box protein PP2-B24883e-048
Q9FLU7 Putative F-box protein PP2-B124623e-045

TrEMBL top hits (Blast detail)Scoree value
B9HB84 Predicted protein5145e-050
B8AEV9 Putative uncharacterized protein5064e-049
C6TM55 Putative uncharacterized protein5047e-049
C6T4B4 Putative uncharacterized protein4974e-048
C6TEE7 Putative uncharacterized protein4885e-047

Arabidopsis top hits (Blast detail)Scoree value
AT1G80110.1 ATPP2-B11 (ARABIDOPSIS THALIANA PHLOEM PROTEIN 2-B11); carbohydrate binding10628e-116
AT2G02240.1 MEE66 (maternal effect embryo arrest 66)4991e-050
AT2G02360.1 AtPP2-B10 (Phloem protein 2-B10); carbohydrate binding4963e-050
AT2G02250.1 AtPP2-B2 (Phloem protein 2-B2); carbohydrate binding4883e-049
AT5G24560.1 AtPP2-B12 (Phloem protein 2-B12); carbohydrate binding4784e-048

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
66  25%
 
86  25%
 
122  8%
 
95  21%
 
103  13%
 
202  8%

Unigene MembersMember information