Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN20039

FASTA Sequence
Unigene ID: UN20039Length: 386  SNP
GGAGGCCTGCAAGAACTTTAGAACACACACAAAAAAAACTAAGTAAAAAGAAGAAAAAGCCTTCCAGGTCTCAACAATGGAGATGA
AGAAGATCGCTTGTGGTGTGCTTTTCGCTGCTGCCTCCATGACCGCCGTCATGGCTATTGAGGAAGCCGGAGCTCCGGCTCCAGGA
CCCGCATCCGCCGCCTCGGTTGCATTGCCGGCTCTTGGCTCTTTGGTTGGGGCTTCCCTTGTGTCCCTATTCAGCTACTACTTGCA
CTAAGCTATGTCTTCATTATGTAATAATACTATTTATGTGATCTTTTTCATTTCCTACCTATTTCCATTTCACTTGTTTATTAATA
AAACTGAGAAAATAATTCAAGAATAAACTTTCTTTTGTTTGC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_191328 arabinogalactan protein 23 [Arabidopsis thaliana]2827e-024
AAD21078 pollen-specific arabinogalacta protein BAN102 [Brassica rapa subsp. campestris]2764e-023
AAM18712 arabinogalactan-peptide AGP23 [Arabidopsis thaliana]2764e-023
XP_002876432 expressed protein [Arabidopsis lyrata subsp. lyrata]2711e-022
NP_973662 uncharacterized protein [Arabidopsis thaliana]2371e-018

Swiss-Prot top hits (Blast detail)Scoree value
Q8S2W4 Arabinogalactan peptide 232823e-025

TrEMBL top hits (Blast detail)Scoree value
Q9XEY8 Pollen-specific arabinogalacta protein BAN1022762e-023
Q3EBI2 At2g419052378e-019
B9N6U6 Predicted protein1973e-014
B9HNM7 Predicted protein1931e-013
B9II47 Predicted protein1912e-013

Arabidopsis top hits (Blast detail)Scoree value
AT3G57690.1 AGP23 (ARABINOGALACTAN-PROTEIN 23)2833e-026
AT2G41905.1 unknown protein2384e-021

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
62  18%
 
112  18%
 
71  9%
 
82  18%
 
103  27%
 
91  9%

Unigene MembersMember information