Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN20205

FASTA Sequence
Unigene ID: UN20205Length: 1334  SNP
CGAAATATGATATGAATAGGAAGTAGAAAAAAAAGAGTATTTTGGGGGTAATGATTGTCTCTTTAGATTGTTGATGGAAAATCATC
ACATGCAGAAGAAAGATGAAGAATTGACAATGGCATCAGCTCCTTTATCTACATAATAATATTAATAAACCCTCTCACAATCTTGC
TTAGTAGACTTCCACATTCCACTGCTCACTCTTCTTCAATTGCTTCTTGTACTCCAACCAATCGATCCCATCTTTAGCAGCAAGTG
AGACCATGATCTCATCGATACCCTTCTCCATACCCTTGAGACCACACATGTAAACAAAGGTGTTGTCTTTCTTCAGCAACTCCCAC
AGCTCTTCTGCATACTCTGCCATTCTTGTCTGTATGTACATTTTCTCTCCCTTCTCGTTTGTCTGCTCTCTGCTCACCGCAAAGTC
CAACCTGAAATTTTCCGGGTTCTTCTCCTTCATCTTCTCAAACTCCTCCTTGTAGAGCAATGAGCTGCTTGTGGGTACACCCAAGA
AGAGCCATGCCAAACCGTTGAACTTGTAGTCCTCATGCTCCTCAAAGAACATTTTCCACAAAAATGATCTGAATGGTGCTATTCCA
GTTCCTGTTCCAAGCATGATGATGGTGGCATTAGGATCTTTAGGCATAAGCATTTCCTTTCCAACTGGTCCAGTGATCTTTGCCTC
ATCACCAGGCTTCAAGTCACACAAGAAGTTGGAGCAGACTCCCTTAACAAGCTCTCCGCTTTCGTTAGTGTAAACTAATCTCTTGA
CACAGAGAGAAACGGTTTTGGAATCACCAAAGTCACCAATGGCACTGCTGGCGATAGAGTATAACCTCAGCTTGTGGGGCTTCCCG
TTCTTGTCAATTCCTTCTGGAATCACTCCTATCGACTGCCCTTCTCTGTATGGAACCTCCCCTTCGGTGCTGAAGACGATGTGCCA
GGTTTCACCGGGAGCGTCATCGCCAGTGATCCTGGTGTTCAAGAGGCATCTACCAGTGTAAGGCTCCTTTGGTTTGAATTTGTTGA
CAACAATCCCTTCTTCCTGTTTCTTTGACTCCTTGACTACTTTCACTGGCGTCTCTGTTGACACCTGAGCCTTCACTCTTCCCCTA
TAAATACACGCCTCTCTGTAGCACACTCTGCTCTTGTTGTTGAGGAAAATCCTTTGAGGGGAGACGAAGGAAGTTTTGGAGGGAAG
AGAAGAGGACTTGGATGAAGGATAAGAGACTGCAGCACCTATTGCAGCAGCCATGTTTGATCAACTATGCAACGAAGATGGGCCTC
TCTGTTTTTAGCTTCTCATTCGTCTCTGTTCAACATTTTCCTCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002865083 ferredoxin-NADP+ reductase [Arabidopsis lyrata subsp. lyrata]17182e-189
NP_201420 ferredoxin--NADP+ reductase [Arabidopsis thaliana]17066e-188
BAE98556 ferredoxin-NADP+ reductase [Arabidopsis thaliana]17031e-187
CAB52472 ferredoxin-NADP+ reductase [Arabidopsis thaliana]16771e-184
XP_002327750 predicted protein [Populus trichocarpa]16295e-179

Swiss-Prot top hits (Blast detail)Scoree value
Q9FKW6 Ferredoxin--NADP reductase, leaf isozyme 1, chloroplastic17062e-189
P10933 Ferredoxin--NADP reductase, leaf isozyme, chloroplastic16005e-177
P41346 Ferredoxin--NADP reductase, chloroplastic15772e-174
O04977 Ferredoxin--NADP reductase, leaf-type isozyme, chloroplastic15281e-168
P41343 Ferredoxin--NADP reductase, chloroplastic15271e-168

TrEMBL top hits (Blast detail)Scoree value
A9PJ48 Putative uncharacterized protein16293e-179
B9MXF5 Predicted protein16293e-179
A5BG49 Putative uncharacterized protein15944e-175
B9GZ04 Predicted protein15872e-174
Q9M4D2 Chloroplast ferredoxin-NADP+ oxidoreductase15684e-172

Arabidopsis top hits (Blast detail)Scoree value
AT5G66190.1 FNR1 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 1); NADPH dehydrogenase/ electron transporter, transferring electrons within the cyclic electron transport pathway of photosynthesis/ electron transporter, transferring electrons within the noncyclic electron transp17124e-191
AT1G20020.1 FNR2 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 2); NADPH dehydrogenase/ oxidoreductase/ poly(U) binding14123e-156
AT1G20020.3 FNR2 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 2); NADPH dehydrogenase/ oxidoreductase/ poly(U) binding14088e-156
AT5G66190.2 FNR1 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 1); NADPH dehydrogenase/ electron transporter, transferring electrons within the cyclic electron transport pathway of photosynthesis/ electron transporter, transferring electrons within the noncyclic electron transp12922e-142
AT1G20020.2 FNR2 (FERREDOXIN-NADP(+)-OXIDOREDUCTASE 2); NADPH dehydrogenase/ oxidoreductase/ poly(U) binding9751e-105

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
105  13%
 
67  18%
 
76  15%
 
86  15%
 
124  10%
 
181  3%
 
96  15%
 
115  13%

Unigene MembersMember information