Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN20209

FASTA Sequence
Unigene ID: UN20209Length: 1251  SNP
TTTTTGGCTAAAGAAACAACCTTTGATCTGAGAGAGTGGGAGCGGCGATTGTAGAATTGGAGAGTCGATCTCTGAGTTAGCTAAAT
CGCAGGGAGGGACGTTTACTGAGATTGAGGCGAAGTCATCATGTCTTCGGATCCTGAAAAGATGATGTCCAAAGCCGACAAGATGA
CAAAACTCACGCTTACTAGGTGGAGTGCTGACTGGAGAGGTGCTACTGAGTTGTATGAGCAAGCAGCAAATGGCTTCAGGGCATCA
AGCAAATATGAAAAAGCTAAAGTGGCTCTCGAGAAAGCTTCCAAAGGACAAGAGATGCAATCTTCTCCCTGGGATGCTGCAAAGCA
TATGGAGTCTGCCGCTGCCCTAGCGCAGAAGCTAAGTATCTGGAACGAAGTTGCTGATTTTTATAGAAAGGCGTCTGAGCTGTATG
TTGAGTGTGGAAGGGCACAACCCGCATCAGATGCTCTTGGAAAGGCTGCTCGTGCTTTGGAAGAAGTCAAACCTGAAGATGCCATC
CAACTGTACACCGATGCTTGTGAAATTCTTGAAGAAGATGGAAGGGACCAGATGGCTTTTGATCTGTACCGTGCTTGTGCTAGTGT
TTACATAAAACTCGAGAAGTTCGCAGATGCTGCAACCTTTTTCTTAAGATTGGGTGTAGCAGCTGACAAGTGTGACGCCACAAATA
GCCAGTGTAAGGCATATCTTAGTGCAATCATTGTATATCTGTATGGCCATGACCTGAAGCAGGCTGAAAAATGCTACAACGATTGT
TCTCAGATTGATGCTTTTCTGAAGAGTGATCAGAACCGAACTGCTAGCAGACTGCTCACAGCCTATAATGAAGGTGACATCGAAGA
AATCAAGAAAGTGGCGTGTTCAAGCACTGTCAACAATTTGGATCATGCGATCATCAAGTTGGCGAGAAAGCTACCCACAGGAGATG
TCACTGCAGTTCAGATGAATGCTGGTGATGATCTCGACGAGGATGATCTCACTTGAAGATTCTTCTCTTTGTACAGATTTCAGATT
CCTACACTTTGCTTATGTTCAAGCCAAACTACTTAAAACAAAGTTATCATTTTAGTCCAAACCTTCCTTGTGTGAATGAATGATTG
GCTATAAAGGCTCTGAGTTCAGATGTGTGCTTTGTTCCTCCATTAAATCCACAGTGGGTTACCACTTGAACACTCTTTTAGCACAG
GCTGGTAAATTTCTTCATTTGACAATAAATATGATACAGTTGTTACC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_567600 Gamma-soluble NSF attachment protein [Arabidopsis thaliana]14153e-154
XP_002867883 predicted protein [Arabidopsis lyrata subsp. lyrata]14144e-154
AAM63730 unknown [Arabidopsis thaliana]14063e-153
T10583 hypothetical protein F9F13.60 - Arabidopsis thaliana12863e-139
XP_002276285 PREDICTED: hypothetical protein [Vitis vinifera]11601e-124

Swiss-Prot top hits (Blast detail)Scoree value
Q9SPE5 Gamma-soluble NSF attachment protein14151e-155
Q9U9R7 Gamma-soluble NSF attachment protein3872e-036

TrEMBL top hits (Blast detail)Scoree value
Q24JN4 AT4G20410 protein14152e-154
B9SV66 Gamma-soluble nsf attachment protein, putative11411e-122
Q0WT89 AT4G20410 protein (Fragment)11356e-122
B7FIS3 Putative uncharacterized protein11302e-121
B9NA98 Predicted protein11302e-121

Arabidopsis top hits (Blast detail)Scoree value
AT4G20410.1 GSNAP (GAMMA-SOLUBLE NSF ATTACHMENT PROTEIN); binding / transporter14168e-157

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
114  21%
 
103  16%
 
123  16%
 
72  11%
 
66  32%
 
81  5%

Unigene MembersMember information