Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN20225

FASTA Sequence
Unigene ID: UN20225Length: 1518  SNP
TGCAAAGAAGAAGTAAAGTTGATAAGTAACTTTTTGTTCTTTTCTTTTACTTCTAAGCAGAGACTCTCTGAAACCCCAAACATACA
AATAAAGAAGTACCTCAAAGTTCCAAAAAATCTTTAAAAGAAAACAAAAGAGACGGACACATCTGCTTCTCATTCTTGAGCATTGC
TGCTTGTTTCCATTGGCTCAGCCTCCGTTGAGGTCTCCCCTCCTTTCTCTCCAGCCTTCTTGGCTTTCTTCTTCTTTCCACCACCC
TTCTTCTTCTTGGTAGCCAAGGCTAACCACCCTTTGATCTCAGGGTTGTCATCAATGGTCTTCGTAGGTTGAAGCTCCTGAAGTGT
ATGTGAAGTGATCCTATCCGAACCATTTGGCATCAGCAAAACTGTGAACTTGATTTGAGCAACAAAATCCCCAGGCTTCTCGTAAA
GTACAGGATACGGTAGCAAATGGCCATGGTTCACACACTCCACAAGTCCAAGACGTGCCCTTTTCTCCTCCAGTGACCTTGCAGTG
AATGGCATGTGGGGAAAGTTTTCTTTAATCTCGCTGAATATGAATCTGGAGGCTTTCATCTTCAACTGATATTTAACATCCGCATC
CTTCTTGTAAACAGTTGTTTGCTTCTCGTCTAAAAGCTTCGGCTTGCCATCACCAGTGCTGGCCACAATATCTACGGAATAGACTT
CATTCTCTTCAAACTCAGCATCATCAACCCTTGTCTCTGGAGTGGATACACTTAGGAAACACTTGCTTCCATCTATCACATTCTGT
TTCATCTGGTGGGAAATAACCCCTTCCACAATTTTGCAGTCATAAGCTTCAGCCACCTTCTGAATAGCTTCAGTGACAGCATGGTT
CTTCTTCCCAGGACGAACGAGCCTCAAAGCAACTTCAGCAGCAGTATTGGCAGCAGCAATAACATCAGCTTTGCGTCCAGTAACAG
GCCCTTCTTGAAGAACATGTGTGTGTGCAACAAGAGCAATGAACCCATCAATATGGCATCCCATATCAATTTTGAGCATATCACCC
TCTTCCAACACAGTCTCGTCACTTGCAAGCGGCGAGAAATGACCGACGGTGTTGTTCACAGACACGCACGTGGGGAAAGCCACACC
TCGGTCAATCTTCTTCTTGGCGTTCTTGTACATGCTCCCTGTTTGCTCTTTGATAAAGGTGTCTCCTTTCTCGCAGATATCGACAA
TCTTAGCTTTTGGCTTGCATTCAGACAAAACAAACTGCAACGCCTTGTTAACGATCTCAGCGGCGCTCTTGTACTTGGTGACGACT
TCGGAACAGGTGAGATCCAGCTCCTTCTCGTCTCTCTCATCGTCAGAACTCATCTCTCGAAGGTCGTTAACTCGCTAGGGGTTTAA
GGAAATGGTTAGAGGGGTGGGGAGGGGGAGCTATTGAGGGAAAGAATGGGTCAGAAGAAGTGTGAGACGACGTTTTGCTCAAATAA
AGACACTAGGGTTTTCGCTATGTGTCGTCTCTTCTTAACGACACCGTTTACAGACC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_190748 metallopeptidase M24 domain-containing protein [Arabidopsis thaliana]17408e-192
AAK25936 putative nuclear DNA-binding protein G2p [Arabidopsis thaliana]17372e-191
NP_850679 metallopeptidase M24 domain-containing protein [Arabidopsis thaliana]17344e-191
XP_002877825 hypothetical protein ARALYDRAFT_906530 [Arabidopsis lyrata subsp. lyrata]17211e-189
XP_002308228 predicted protein [Populus trichocarpa]16403e-180

Swiss-Prot top hits (Blast detail)Scoree value
Q9UQ80 Proliferation-associated protein 2G48846e-094
P50580 Proliferation-associated protein 2G48792e-093
Q1ZXG4 Proliferation-associated protein A7493e-078
Q09184 Curved DNA-binding protein6552e-067
Q55C21 Methionine aminopeptidase 22502e-020

TrEMBL top hits (Blast detail)Scoree value
Q96327 Cell cycle-related nuclear binding protein17405e-192
Q9C5I5 Putative nuclear DNA-binding protein G2p17371e-191
Q3EAL7 Putative uncharacterized protein At3g51800.217343e-191
A9PF64 Predicted protein16402e-180
B9SWY5 Proliferation-associated 2g4, putative16285e-179

Arabidopsis top hits (Blast detail)Scoree value
AT3G51800.1 ATG2; aminopeptidase/ metalloexopeptidase17555e-196
AT3G51800.2 ATG2; aminopeptidase/ metalloexopeptidase17351e-193
AT3G59990.1 MAP2B (METHIONINE AMINOPEPTIDASE 2B); aminopeptidase/ metalloexopeptidase2762e-024
AT3G59990.2 MAP2B (METHIONINE AMINOPEPTIDASE 2B); aminopeptidase/ metalloexopeptidase2762e-024
AT3G59990.3 MAP2B (METHIONINE AMINOPEPTIDASE 2B); aminopeptidase/ metalloexopeptidase2762e-024

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
115  24%
 
123  14%
 
103  14%
 
86  29%
 
73  14%
 
61  5%

Unigene MembersMember information