Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN20234

FASTA Sequence
Unigene ID: UN20234Length: 1349 SSRSNP
GGGCACACGAATTTTCAAATCTCCTCCTCTCTCTCTCTCTCTCTCTGTTTTCCTCGTAGATCCCTCTGTTTCCCTTTCTGTCTTTC
GAATCTGAAGATCATGTGTGAGAACGCCATGTCAGGTCATCTCAAGAAACTAACGATCGACACAGGACGTTCAGAGACTCTCGTGG
TCTGTTTCGGTGAAATGTTGATCGATTTTGTGCCAACGGTGGGAGGTGTTTCGCTCGCTGAAGCACCAGCTTTCAAGAAAGCTCCA
GGAGGTGCACCTGCTAATGTTGCTGTTGGTGTCTCTAGACTCGGTGGCTCCTCTGCTTTCATTGGAAAGGTTGGTGATGATGAGTT
TGGAAAAATGTTAGCTGAGATTCTAAGGCTGAACAACGTGGACAACTCTGGGATGAGATTCGACCACAAAGCACGTACTGCTCTCG
CCTTTGTTACGCTAAGAGCTGATGGAGAGAGGGAGTTTCTGTTCTTCAGACACCCGAGTGCTGATATGCTTCTCACGGAGTCTGAG
CTTGACAAGAACTTAATCCAAAAGGCCAAGATCTTTCATTACGGATCAATCAGTTTGATCAAGGAACCTTGCCGATCGACTCATCT
CGCAGCCATGAAAATCGCTAAAGCCGCAGGGAGTCTCTTGTCGTATGACCCAAACTTGAGGTTACCATTGTGGCCATCAGAGGAAG
CTGCAAGGAAAGAGATCATGAGTATCTGGCATCTAGCTGATGTTATTAAGATCAGTGAGGATGAGATTACATTCCTGACTGGTGGA
GATGATCCTTACAGTGATGAAGTTGTGTTGCAAAAGCTGTTTCATCCAAACCTTAAGCTTCTTGTTGTTTCAGAAGGACCTAATGG
GTGTAGATACTACACTAAGGCGTTTAAAGGTAGAGTTGGTGGAGTGAAAGTGAAAGCGGTTGACACAACAGGTGCAGGAGATGCAT
TCGTGAGCGGTCTTTTGAACAGCTTAGCTTCTGATCTCACTCTTCTCACTGATGAGAAGAAGCTAAGAGAGGCGCTTCTATTCGCA
AACGCTTGTGGAGCCATTACTGTAACAGAGAGAGGAGCGATTCCAGCGATGCCCACCATGGATGCTGTTCAAGAACTTGTCAAATC
TTCTCGCTCCTGAAAATGCTCATAAAGTCTCTTTTTGAGTGAACTCAGTTCCATTCCCTGTATCTTTCTTTGTTTGTTTTTTCTCT
CTTTTTTCCCAATTTGTAGGAACTCGAGAATGTTGTGTGTGTGTGTGTTGATCTTCTGGAGTTTTGATTTGGTTTTAAACTGCTTG
TCGTTTATTGTTGCGGAGTAAGGATATTTTAGTTTTAAACTGCTTGCCGTTTCGTTTTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002864134 pfkB-type carbohydrate kinase family protein [Arabidopsis lyrata subsp. lyrata]16062e-176
NP_199996 fructokinase [Arabidopsis thaliana]16044e-176
XP_002263176 PREDICTED: hypothetical protein [Vitis vinifera]13553e-147
XP_002272526 PREDICTED: hypothetical protein [Vitis vinifera]13383e-145
CBI38824 unnamed protein product [Vitis vinifera]13383e-145

Swiss-Prot top hits (Blast detail)Scoree value
O82616 Putative fructokinase-510826e-117
Q7XJ81 Fructokinase-210736e-116
Q42896 Fructokinase-210736e-116
Q0JGZ6 Fructokinase-110673e-115
A2WXV8 Fructokinase-110664e-115

TrEMBL top hits (Blast detail)Scoree value
Q9FLH8 Fructokinase 116043e-176
A5BUI9 Putative uncharacterized protein13363e-145
B9I4G8 Predicted protein13248e-144
O04897 Fructokinase13113e-142
Q8H277 Fructokinase12996e-141

Arabidopsis top hits (Blast detail)Scoree value
AT5G51830.1 pfkB-type carbohydrate kinase family protein16051e-178
AT1G66430.1 pfkB-type carbohydrate kinase family protein12205e-134
AT4G10260.1 pfkB-type carbohydrate kinase family protein10825e-118
AT3G59480.1 pfkB-type carbohydrate kinase family protein10638e-116
AT2G31390.1 pfkB-type carbohydrate kinase family protein10621e-115

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
61  8%
 
182  17%
 
212  17%
 
202  17%
 
102  17%
 
92  17%
 
81  8%

Unigene MembersMember information