Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN20269

FASTA Sequence
Unigene ID: UN20269Length: 765  SNP
GGGACACTCAATTCACCCACAACATAGCTAGTGGAACAGTGTATTCTAAAAAAATGGCTTCAAGCTCCATAGCCCTTTTCTTGGCT
CTCAACCTCATGTTCTTCACAACAATCTCCGCATGCGGTAGCTGCACTCCTTGCGGAGGAGGTTGCCCCTCTCCCAAGCCCAAGCC
AACTCCTAAACCAACCCCAAGCCCTAGCTCTGGCAAGGGAAAGTGCCCTAAAGATACCCTCAAGCTTGGTGTCTGCGCCAATGTAC
TCAATGGCCTCCTCGACTTGACCCTCGGCAAGCCACCGGTCAAGCCATGCTGTAGCCTCATCCAAGGACTCGCTGATGTTGAAGCA
GCCGTTTGTCTCTGCACCGCTCTTAAGGCTAACGTTCTTGGAATCAACTTGAACCTCCCAATCTCTCTAAGTCTTCTCCTCAATGT
TTGCAGCAAACAAGTTCCTCCTGGCTTCCAGTGCTAAGCAATCGTACCATATGTAATTTCAGTACACGAATGTGTATATTTATCTT
CTTGTTTTGGACAGACAAGGTGATTCTGTTTACTCTTATTATTGTGTCCCTCTATATTTGTGTTCTTATTACAATCTTCTTGTTAT
GGGGTTCATTGGAGCCAAATTGTGTCTCTATCCGGATGATCCTTACGATTCTTGAAGTTAACAGTTCCATTATTTCCCGTTACTCT
TTATATTGGGGTAATTGTTGTACTATGATCCTATGAAAATAAATCAATTATATTTTATGTTATACGTTAAAAAAAAA

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_172673 extensin-like protein [Arabidopsis thaliana]7115e-073
AAK30571 extensin-like protein [Brassica napus]7044e-072
XP_002892674 hypothetical protein ARALYDRAFT_471359 [Arabidopsis lyrata subsp. lyrata]6963e-071
XP_002529775 14 kDa proline-rich protein DC2.15 precursor, putative [Ricinus communis]5386e-053
ABG91752 HyPRP2 [Gossypium hirsutum]5262e-051

Swiss-Prot top hits (Blast detail)Scoree value
P14009 14 kDa proline-rich protein DC2.154424e-043
Q01595 Cortical cell-delineating protein2722e-023
Q00451 36.4 kDa proline-rich protein2516e-021
P24337 Hydrophobic seed protein1441e-008

TrEMBL top hits (Blast detail)Scoree value
O65369 At1g12090/T28K15.147114e-073
Q9AT52 Extensin-like protein7042e-072
B9SUW4 14 kDa proline-rich protein DC2.15, putative5384e-053
Q0PIW2 HyPRP25261e-051
P93512 Proline-rich SAC51 protein5251e-051

Arabidopsis top hits (Blast detail)Scoree value
AT1G12090.1 ELP (EXTENSIN-LIKE PROTEIN); lipid binding7122e-075
AT1G62510.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein4666e-047
AT4G12520.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein4317e-043
AT4G12510.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein4317e-043
AT2G45180.1 protease inhibitor/seed storage/lipid transfer protein (LTP) family protein3861e-037

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
614  25%
 
721  38%
 
114  7%
 
103  5%
 
85  9%
 
126  11%
 
92  4%

Unigene MembersMember information