Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN20501

FASTA Sequence
Unigene ID: UN20501Length: 922  SNP
GGAACGCCCAATTCTCTACGGATCTGCAAACTCTGTTGATTCCTTCTTCTTCTTCATCTCCTAGTACCGAAGCAGTAGCTCTTGAT
TTTTTCAGACAAAAGGAATATCTAATGGGACCCAAAGCTGGAGTCTTTGTTCTTTTCTTGCTGGGTTTGTCCCTTCTTTCTCACGC
TAGATCCTTCCTTCCCTCCACCCTCTCAGAGGAAGTGTACAAGGATGAAAAGGTTTGCAGTCTATGTGAGGAGTATGTTAACTCTG
CTCTCAGCTACCTTGAGAAAAACGAAACACAGAGTCAGATATTAGAGGACCTTCATGACCAGTGTTCCCATATCCGCGGATTTGAA
CAACAGTGCATAACTTTGGTTGACTACTACCTCCCTCTCTTCTTCTTGCATCTTGAGTCCTTTCAACCTCATTATTTCTGCAAGCG
GTTGAATCTTTGTGGTCACGTCGTAGCTCTTGTTGAAGAAGCTCGTCAGGATACTTGCGATGTTTGCCACAGGACTGTTTCTGAGA
TTCTCATCAAACTACAAGATCCCGACACACAGTTGGATATAGTTGAGCTGCTTCTTAAGGGATGCAAATCGTTCAAAAACCACGAG
TACGAGAAGAAGTGCAAGAAGTTGGTGTTCGAGTATGGACCTTTGATCCTCGTGAATGCAGAGGAATTCCTAGTGAAAAACGACAT
CTGCACACTCTTACGCGCATGTCCCAACCAGCAAACGGTTCTAAGGCAGTCAGCAGCAGGCTTGGCGGATTCTTGAACAACAAGTT
TGATTGTGTATTTGTCCATAAGAATTGTCGCATAGGGTTTGTAAACTTGTTGGATTTAGATACAGACTCTCTCTATCTGTCCATTG
GACCATCACCAACTGCTTGTATTATACAAAATAAAATATACTCTTTATTCTTCTTTTCACCG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAJ33968 unnamed protein product [Thellungiella halophila]9152e-096
XP_002876101 predicted protein [Arabidopsis lyrata subsp. lyrata]8821e-092
NP_190741 saposin B domain-containing protein [Arabidopsis thaliana]8757e-092
XP_002533718 conserved hypothetical protein [Ricinus communis]5486e-054
XP_002323058 predicted protein [Populus trichocarpa]5111e-049

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q9SCT5 AT3g51730/T18N14_1108755e-092
B9T649 Putative uncharacterized protein5484e-054
B9IGQ2 Predicted protein5118e-050
B9HDA3 Predicted protein5045e-049
C6T5S5 Putative uncharacterized protein4732e-045

Arabidopsis top hits (Blast detail)Scoree value
AT3G51730.1 saposin B domain-containing protein8753e-094
AT5G01800.1 saposin B domain-containing protein4604e-046

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
93  17%
 
67  39%
 
212  11%
 
112  11%
 
83  17%
 
181  6%

Unigene MembersMember information