Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN20618

FASTA Sequence
Unigene ID: UN20618Length: 559  SNP
GGAAAACTACAACTGAGAATCTTCTTTATTTTCTTAAAGGAAAAAAAATGTCTGGTCGTGGAAAGGGAGGAAAGGGTTTGGGCAAA
GGAGGAGCCAAGCGTCACAGGAAGGTTCTGAGAGACAACATCCAGGGAATCACCAAGCCTGCTATTCGGAGGTTGGCTCGCAGGGG
TGGAGTCAAGCGTATCAGTGGTCTGATCTACGAGGAGACACGTGGAGTCCTCAAGATCTTTTTGGAGAACGTCATCCGTGACGCCG
TGACCTACACCGAGCACGCCAGGAGGAAGACTGTGACGGCCATGGATGTCGTCTATGCGTTGAAGAGGCAAGGGAGGACGCTTTAC
GGATTTGGCGGTTGAGGGTCTTTTGAGATTCGCGTTTGCGTTTCTGGGTTTCTTTTAGGTGTTGTTCTGGAAATTTCTAATCAAAT
CGTGTTATTTGCGTTTTTAATTCTGTTTGGTTACGGTCTTTGTGTGTTGCGGTAGCGTTTCGTTACATGTAATGTAATTACGCATT
TTATCTATGAAGCTGTTCGAGTTTATGAATCTGGACTTTCTTT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAK03333 predicted protein [Hordeum vulgare subsp. vulgare]5312e-052
XP_853963 PREDICTED: similar to germinal histone H4 gene [Canis familiaris]5302e-052
XP_002746145 PREDICTED: hypothetical protein LOC100405337 [Callithrix jacchus]5276e-052
EFB21580 hypothetical protein PANDA_016833 [Ailuropoda melanoleuca]5241e-051
XP_002721657 PREDICTED: histone cluster 1, H2ag-like [Oryctolagus cuniculus]5241e-051

Swiss-Prot top hits (Blast detail)Scoree value
P62785 Histone H4 variant TH0115239e-053
P59259 Histone H45239e-053
Q6PMI5 Histone H45239e-053
Q6WZ83 Histone H45239e-053
Q6LAF3 Histone H45239e-053

TrEMBL top hits (Blast detail)Scoree value
D2HWI2 Histone H4 (Fragment)5249e-052
A2WWR4 Histone H45231e-051
A5B4J3 Histone H45231e-051
A5HSG5 Histone H45231e-051
A9NJR8 Histone H45231e-051

Arabidopsis top hits (Blast detail)Scoree value
AT1G07660.1 histone H45247e-054
AT1G07820.1 histone H45247e-054
AT1G07820.2 histone H45247e-054
AT2G28740.1 HIS4; DNA binding5247e-054
AT3G45930.1 histone H45247e-054

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
114  24%
 
122  12%
 
82  12%
 
92  12%
 
101  6%
 
66  35%

Unigene MembersMember information