Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN20774

FASTA Sequence
Unigene ID: UN20774Length: 1127 SSRSNP
GGGCCTCTCTCTCTCTCACACACACACAAAAATCTTCTCTGTCATCGTTCTCTCTCTCTCTCTCTCTCCCCTCTCGGAGATTTTAC
TCAGGGCGTTGATAAGAAAAAATGAATCAATACAACCTTCAGCAGAAGAACAACGCCTTCATGATGTCTCGCCGCGAGGAGGAGAT
GATGGGACTTGATCGCAGCAACAAGGAGGATCTTGTCGTTTGTCCTAAGCCTAGACGTGTCGGCTTACTCGTCACTCGCCCTCTCA
GATTACATGTGAGTCAAGCTGCTGCTGATCTGTGTGATTCGAAAGCGGGCGCAGAGCTTTTGGACATCATCCGTAGAAAGGAGGAC
AATGGTACAATAGGGCAGTTACTACCACCTTCATCGCCACCGTACTTTCCCGGTTCTCCCCCGAGCAGAGCAGCGAACCCGTTAGC
CCAAGATGCACGCTTTCGTGACGGCGAGAAGCTCAACTACCCACTCTCTTCACCAAACTCTCCTTTCCTTCAGCCCGGTTCATCAT
CATCAGCCGGCTTCCCTTATCCATCAACATCAACATCATCATCGTCGTCGTCTCGTGGTTGCGCTCGAATGAAATTTGGGCTCAAA
CCACCTGCAGTTAGAGTAGAAGGGTTCGATTGCTTGAACCGTGACCGCCAGAGCTCCAGCATCCCCGCCATGGCTTAGTAGACAAA
AGCCAACAATAAAAAAACAAGTGTATATACAGAGAGATTCCGGACCAAGGCCCTAACAGAGAGAAGGATTTGATTACTAGTGTTAC
TACTACATTTTTGAAGCAAATGAATATGTGATATCTATTTAGTGTTTTCTTTTTTTTTCATCTTTTCCTGAGAGAGAGAGAGGGAG
GATGAAGATGAAGATCGGGTCACCGTTTTGTTAATACATTAATAATTAAGGAGAAGATTAGAAAGAAGAATCTGTAAAATTTTATC
TTGGAGAAGAGGTCTGGTTTGTATCTTTTTCCTTTTGATTTCGTTGTAATATAAAATTATCTTCTTTACACCATTGTGTATAGTAG
TGGGCTGAGCATAAGCTCTCCAACAACACCTTTGTATATGTTTATCTTTGTGATTTGACGAATCTGTATATTAAAAGCACCGTATT
GTTCTTACC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_568326 uncharacterized protein [Arabidopsis thaliana]7128e-073
BAF02167 hypothetical protein [Arabidopsis thaliana]7128e-073
AAG40362 AT5g16110 [Arabidopsis thaliana]6563e-066
XP_002873758 AT5g16110 [Arabidopsis lyrata subsp. lyrata]6553e-066
XP_002329333 predicted protein [Populus trichocarpa]3831e-034

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q0WL40 Putative uncharacterized protein At5g161107126e-073
Q9LF17 Putative uncharacterized protein T21H19_307126e-073
Q9FPI4 AT5g161106562e-066
B9N232 Predicted protein3838e-035
C6T919 Putative uncharacterized protein2422e-018

Arabidopsis top hits (Blast detail)Scoree value
AT5G16110.1 unknown protein7132e-075
AT3G02555.1 unknown protein2643e-023
AT1G13390.1 unknown protein2123e-017
AT1G13390.2 unknown protein2123e-017
AT1G68490.1 unknown protein1918e-015

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
124  24%
 
113  18%
 
192  12%
 
213  18%
 
203  18%
 
62  12%

Unigene MembersMember information