Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN21080

FASTA Sequence
Unigene ID: UN21080Length: 649  SNP
AGCTCACGTAAAACTTCTAAGCCTGGTGGTATTTTCTATTTGAACAAATGCATGCGATGAAGACATTATAAACATAAAGACACTTA
AATATTTATTTAGATCTCCCCCTCAGGTATCTTGAGAATTTTGTTTAAGAAATCTACAATGGTTACAAATACACAATAAAATAAGT
TTTATATAGCACCAATGTTTTTTAGGCCAAGGACAACTCCTACTCCGATGATATGACCAACGGTGCCACAGGCCAACGTGTCAGCG
AGCGTGAATCCGGCTGGATCACCCGTTTGTAGACCCGAGTCACGTGCCTCCAGCTTAAGTCCAGCTGTTGCTTTCCTATTTGCTGA
TGGTGCAAGTCCGAATCTCCCCGCGAACAGCATCAGGGTCGTAGATGTTACCATTATCAGATTTGTTGATGAACCAATGAAGTCAC
CACACTTTGCACCTAATGCACCATTTCCCTTACGTCTCATGGGCTGAACAGTTGCCAGGCGTTGAACAGGAGCTGCGGAGATCTTG
CTGGCACGAAGACCATTGAACTGAGGCAGGGTAGTCATTACAGTGCTCGCCATTTCCTTTGACTGTTACGTTAAACAAACTTAAAT
TTTACTGTGCGATCTGTTTTTCAGTTTTTTTTTTTTGGTTCTAGCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002890866 photosystem I reaction center subunit X psaK [Arabidopsis lyrata subsp. lyrata]6309e-064
ABB97030 unknown [Brassica rapa]6164e-062
NP_174327 photosystem I reaction center subunit psaK [Arabidopsis thaliana]6102e-061
CAB53033 photosystem I subunit X precursor [Arabidopsis thaliana]6066e-061
AAM63834 Photosystem I reaction center subunit X, chloroplast precursor (PSI-K) [Arabidopsis thaliana]6066e-061

Swiss-Prot top hits (Blast detail)Scoree value
Q9SUI5 Photosystem I reaction center subunit psaK, chloroplastic6153e-063
Q9ZT05 Photosystem I reaction center subunit psaK, chloroplastic4971e-049
P36886 Photosystem I reaction center subunit psaK, chloroplastic4281e-041
P14225 Photosystem I reaction center subunit psaK, chloroplastic2604e-022
P14627 Photosystem I reaction center subunit psaK, chloroplastic (Fragment)1403e-008

TrEMBL top hits (Blast detail)Scoree value
Q2V611 Putative uncharacterized protein6217e-063
Q8LC56 Photosystem I reaction center subunit X, chloroplast (PSI-K)6111e-061
A5CAM0 Putative uncharacterized protein5492e-054
Q84QE6 Photosystem I reaction center subunit X psaK5464e-054
Q5EEQ1 Photosystem I reaction center subunit X PSI-K5438e-054

Arabidopsis top hits (Blast detail)Scoree value
AT1G30380.1 PSAK (photosystem I subunit K)6162e-064

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
114  15%
 
89  33%
 
151  4%
 
103  11%
 
93  11%
 
67  26%

Unigene MembersMember information