Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN21099

FASTA Sequence
Unigene ID: UN21099Length: 1818  SNP
GGAAGTCCTCACAACTCGACTTTTCTTTTATATCAGCTTACTCTGATTGTATCTTCTCCTTCTTCAAAACAAAGATAGAACAAAAA
TAAAATAAAAAGAAAGTAAAGAAAAAAGGTTCTGGAATGGAGAGACAAAAAAGCATGGAGAAAGGGTTACTGAGGAAGAGCTTAAG
CATACGAGAGAGAAAGTTCCCAAACGAAGAAGCTTTTCTTGAATCAGGATTATCCAGAAAATCCCCCAGAGAAATTACTAAGAAAG
CTCAAAACGACGATGGTGAATGTCGTGTTACTGCTACTGTTTTCTTTAGCACCTTTGTTGCCGTCTCTGGCTCCTTCTGCACCGGT
TGTGGCGCGGGTTTCTCATCGGGTGCGCAATCAGGGATTACCAAAGATTTATCTCTCTCAGTTGCAGAGTACTCAATGTTCGGGTC
GATTTTGACACTAGGCGGTTTGATTGGTGCAATATTCAGCGGTAAAGTCGCCGATGTCTTGGGAAGAAAGCGGACAATGTTGTTTT
GTGAAGCCTTCTGCATCACAGGCTGGCTTGCTGTCGCATTGGCGCAGGATGCATTATGGCTGGACTGTGGAAGATTGTTGCTTGGA
ATCGGCGTTGGTTTATTTAGCTACGTGATTCCAGTCTATATAGCTGAAATTGCACCAAAACATGTCCGTGGATCGTTTGTGTTCGC
CAATCAACTGATGCAAAATTGTGGCATTGCACTTTTCTTCATTATTGGCAACTTTCTGCCATGGCGATTATTAGCAATAGTCGGCT
TTGTGCCTTGTGTGCTTCACGTCTTTTGTTTATTTTTCATCCCCGAATCTCCAAGGTGGCTGGCGAAGAAAGGTCGTGATAAAGAG
TGTCGATCTGCTTTGCAACGTCTTAGAGGATCTGACGTCGATATTTCTCGTGAAGCAAACACTATTAGAGACACCATAGAAATGTC
CGAAGTGGATGGTGAATCTCGAATGTCTGAACTGTTTCAGAGACGATATGCATATCCGCTACTTATCGGAGTGGGCCTGATGTTTT
TGCAACAATTGAGCGGGAGCTCTGGTGTAACCTATTATGCCAGTAGCCTCTTCAACAAAGGAGGATTTCCAAGTGCTATTGGCACG
TCTGTAATAGCTACGATCATGGTTCCGAAAGCAATGTTGGGAACAATTATAGTCGATAAACTGGGGAGGAGAACACTCCTAATGGC
TTCTTGTGCTGCGATGGGTTTAAGTGCTTTGCTCTTGAGTGTTTCCTATGGGTTCGAGTCATTTGGAATTCTCCCAGATCTCACTC
CCATCTTTACTTGCATTGGCGTATTGGGTCACATTGTGGCATTCGCGATGGGGATGGGAGGACTACCCTGGATTATAATGGCTGAG
ATATTTCCCATGAATGTGAAAGTATCAGCTGGAACCTTAGTTACCGTAACTAATTGGTTATTTGGATGGGTTATCACATATACTTT
CAATTTCATGCTAGAGTGGAATGCATCAGGAATGTTCTTCATCTTCTCGATGGTCTCCGCCTTTTCGATTGTATTTATATACTTTC
TGGTACCGGAGACTAAAGGTCGATCTCTTGAAGAAATACAAGCGTTGCTCTCCAACTCTGTACAATAACTTGTCCTTTTGGGGGTA
AAATGATCATATAAATCGGTTATTTTAACTGATTAGAAATTGATTATTATGATTAGTGTGCGTTTGAATGAGATTTGTGTATGGAT
TGAGTTTTGAATGTGAAAATGGCAACAATAATTTGTATATGGCAATGTTAAAATACGTATTCTGGCACGCTATAAGAAAATCACAT
GCAACGTTACCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_563830 sugar transporter ERD6 [Arabidopsis thaliana]23681e-264
XP_002889723 hypothetical protein ARALYDRAFT_888127 [Arabidopsis lyrata subsp. lyrata]23672e-264
NP_563829 sugar transporter ERD6-like 3 [Arabidopsis thaliana]16119e-177
NP_001031005 sugar transporter ERD6-like 3 [Arabidopsis thaliana]15052e-164
NP_568494 sugar transporter ERD6-like 18 [Arabidopsis thaliana]13384e-145

Swiss-Prot top hits (Blast detail)Scoree value
O04036 Sugar transporter ERD623686e-266
Q94KE0 Sugar transporter ERD6-like 316114e-178
Q94CI6 Sugar transporter ERD6-like 1813382e-146
Q94AF9 Sugar transporter ERD6-like 1113372e-146
Q93Z80 Sugar transporter ERD6-like 1013051e-142

TrEMBL top hits (Blast detail)Scoree value
B1GXJ7 Hexose transporter-like protein16116e-177
A8MR75 Uncharacterized protein At1g08920.315051e-164
B9DGB5 AT3G05165 protein13374e-145
B9MZP9 Predicted protein12962e-140
Q0WQ04 Sugar transporter like protein (Fragment)12424e-134

Arabidopsis top hits (Blast detail)Scoree value
AT1G08930.1 ERD6 (EARLY RESPONSE TO DEHYDRATION 6); carbohydrate transmembrane transporter/ sugar transmembrane transporter/ sugar:hydrogen symporter23694e-267
AT1G08930.2 ERD6 (EARLY RESPONSE TO DEHYDRATION 6); carbohydrate transmembrane transporter/ sugar transmembrane transporter/ sugar:hydrogen symporter23694e-267
AT1G08920.1 sugar transporter, putative16122e-179
AT1G08920.2 sugar transporter, putative15943e-177
AT1G08920.3 sugar transporter, putative15056e-167

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
105  19%
 
62  8%
 
1111  42%
 
72  8%
 
122  8%
 
201  4%
 
82  8%
 
211  4%

Unigene MembersMember information