Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN21237

FASTA Sequence
Unigene ID: UN21237Length: 801  SNP
TTTTTCTTTTTTTCTACAAACATTTTCATTTGTTCAAATCCATTTGCTCCTTCGTCCACAGATCTCCTCCATGGCTCCTATTGCTG
TTGGTAATACTCTACCAGACGGAAAAATTTTCCTCTTTGACGAGAACGATCAGCTCCAGACTGTCTCTGTTCACTCTCTCTTGGCT
GGTAAGAAGGTCATTCTCTTTGGTGTCCCCGGTGCTTTCACTTCCACCTGCAGCTTGCAGCATGTGCCTACTTTCATTGAGAAAGC
GGAACAGCTGAAAGCGAAAGGTGTCAATGAGATCATTTGTTATGGCATGAATGATCCGTATGTGATGAAAGCATGGGGAAATACAT
TCCCAGAGAACAAGCATGTCAAGTTTGTCTCAGACGGCTCAGGAGAATACACAAAGCTTCTCGGACTCGAGCTTGACCTTAAGGAC
AAGGGTCTTGGTATTAGGACAAAGAGATTTGCTATGTTGCTCGATAACCTCAAGGTAACTGTCGCCAACATTGAAACAGGTGGCGA
GTTCACGGTTTCCAGCGCCGATGATATCCTCAAGGCTCTCTAAGAAATTACCATCTGAATTTAGAGGATCTCTAGCCTGATTTGCA
GAATAAGAAGTTGCCATAATAAATTGGTTTAATATTATTTATTTCCTCTCTTTTATTATAATAATGTACTTGGTTTGGGTTGTTTT
CTTTAAGTTTGATTTATGAAGAGTTCAAGTGGTTCACCTTTAGATGCATTCCAAATACAACCATTTTGATGTGGGCTCCAAATGAT
ATGAAAGTTTACCTTGAAATTAAATGC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
AAD33602 type 2 peroxiredoxin [Brassica rapa subsp. pekinensis]7214e-074
NP_176773 peroxiredoxin-2B [Arabidopsis thaliana]7072e-072
XP_002888472 thioredoxin-dependent peroxidase 1 [Arabidopsis lyrata subsp. lyrata]7053e-072
AAM65848 type 2 peroxiredoxin, putative [Arabidopsis thaliana]6991e-071
NP_176772 peroxiredoxin-2C [Arabidopsis thaliana]6982e-071

Swiss-Prot top hits (Blast detail)Scoree value
Q9XEX2 Peroxiredoxin-2B7078e-074
Q9SRZ4 Peroxiredoxin-2C6989e-073
O22711 Peroxiredoxin-2D6891e-071
Q9FR35 Peroxiredoxin-2C6154e-063
Q7G959 Peroxiredoxin-2A5062e-050

TrEMBL top hits (Blast detail)Scoree value
Q2V612 Putative uncharacterized protein7213e-074
Q9XF72 Type 2 peroxiredoxin7213e-074
Q8L9P7 Type 2 peroxiredoxin, putative6991e-071
B4G289 At1g607406891e-070
A9PC26 Putative uncharacterized protein6381e-064

Arabidopsis top hits (Blast detail)Scoree value
AT1G65980.1 TPX1 (thioredoxin-dependent peroxidase 1); antioxidant/ oxidoreductase7086e-075
AT1G65970.1 TPX2 (thioredoxin-dependent peroxidase 2); antioxidant/ oxidoreductase6996e-074
AT1G60740.1 peroxiredoxin type 2, putative6907e-073
AT1G65990.1 type 2 peroxiredoxin-related / thiol specific antioxidant / mal allergen family protein5061e-051
AT1G65980.2 TPX1 (thioredoxin-dependent peroxidase 1); antioxidant/ oxidoreductase4514e-045

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
1115  23%
 
719  30%
 
104  6%
 
181  2%
 
97  11%
 
65  8%
 
129  14%
 
84  6%

Unigene MembersMember information