Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN21329

FASTA Sequence
Unigene ID: UN21329Length: 924  SNP
GGGCCACATCTCAACATCACAGGCTACTCCAGAAAGCAGACGATAATTACCTTTGACATCTCAAGTCTCAAACTCTACATATTTGC
ATCAAATCTATTAATAGTCGAACAGATCAGATCTCAGGATCCTACATTCACATAATAAAACCAATAATGGCTCGCCGCGACGTTCT
CCTCCTCTCCGCCCTCCTCGTCATCGCCACCTTCTCCTCAGTCTCATTCGCCGACGATGATGCAGAATGTGTGTACACATTCTACC
TCAGGACCGGATCGATCTGGAAAGCCGGCACTGAATCGATCATAAGCGCTAGAATCTACGACAAATACGGAGACTACATTGGGATC
CGAAATCTAGAGGCATGGGGTGGGCTAATGGGACCAGGTTACAAGTACTACGAGAGGGGTAATCTCGACATTTTCAGTGGGAAAGC
ACCGTGTCTTCCAAGCCCAGTCTGTTCGTTGAATCTGACCTCCGACGGCTCTGGCGACCACCACGGTTGGTATGTTAACTACGTGG
AGGTCACGACGGCAGGAGTCCACGCTAAGTGCTCGCAGCAAAGCTTTGAAGTTGAGCAATGGCTTGCGACCGATACTTCGCCTTAT
AATCTCACTGCTGTTAGGAATAACTGCCCGGTTTCTCTTAGGGAGAGTGTCGGTCGGGTCGGGTCTGAGATCCGGAAGACTCTCTC
TTGGATCGTGTGAATTGATAAATGAATGAATGTGTGTGTTTTTGGAGACTTGTTCTATGTTGTCTTGTGAACGTGTGATTGCAATA
AAGAAAAATGATTCGATCAAATAAAATTTTCAGTTTTTGTTGATTTAATCAAATATCTATTATTAAAAGTGTATTTTTTTTTTCTT
AACTTAAAAAGAGTGTATTTTCATATGTTGAAGTGAAGGATTAAATATTATAAAGTTGTTGACG

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002880432 lipid-associated family protein [Arabidopsis lyrata subsp. lyrata]8882e-093
AAM62648 dehydration stress-induced protein [Arabidopsis thaliana]8811e-092
NP_565527 PLAT-plant-stress domain-containing protein [Arabidopsis thaliana]8783e-092
AAK01359 dehydration stress-induced protein [Brassica napus]8202e-085
XP_002866880 lipid-associated family protein [Arabidopsis lyrata subsp. lyrata]8202e-085

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q8LEG8 Dehydration stress-induced protein8811e-092
Q9SIE7 Expressed protein8782e-092
Q9AXN5 Dehydration stress-induced protein8201e-085
O65660 AT4g39730/T19P19_1208164e-085
B9H540 Predicted protein5923e-059

Arabidopsis top hits (Blast detail)Scoree value
AT2G22170.1 lipid-associated family protein8791e-094
AT4G39730.1 lipid-associated family protein8172e-087
AT5G65158.1 FUNCTIONS IN: molecular_function unknown; INVOLVED IN: biological_process unknown; LOCATED IN: cellular_component unknown; CONTAINS InterPro DOMAIN/s: Lipoxygenase, LH2 (InterPro:IPR001024), Lipase/lipooxygenase, PLAT/LH2 (InterPro:IPR008976); BEST Arabidopsis thaliana protein match is: lipid-associated family protein (TAIR:AT2G22170.1); Has 83 Blast hits to 83 proteins in 14 species: Archae - 0; Bacteria - 0; Metazoa - 4; Fungi - 0; Plants - 79; Viruses - 0; Other Eukaryotes - 0 (source: NCBI BLink).3672e-035

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
65  17%
 
76  20%
 
86  20%
 
96  20%
 
122  7%
 
112  7%
 
103  10%

Unigene MembersMember information