Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN21509

FASTA Sequence
Unigene ID: UN21509Length: 1525  SNP
CATATTGTGAGTAACTCCTTTCATAATCACCACCATTACAACAAGACTGAGGTATGTGTTCAGAGTATCACCAAATCTTAATATGA
TTATGAAAGACAATCTTTTAATTACATTTTGTGTGCATCATGAATACAAGAAATTACATAATATGTAGTATCGTCAGTAGGCTACA
AACCTGATCGATATATTTACAAACAGATTAAAAACTGTTAAGAGTTTTCGATTATATTAACAAATATATATACGAGGAAAGCTAAC
AGTTGAATTTATAGCGGTACTAGCAGTTCCCTGGTCGGTTATACTTTGGAGGCAGAGATGGACACTGTTCATTCATATGCGTATAA
GGTTCCATAGTGTTGTAACCAGGAAGTTCCATTCTATATTTCCCTAGTATCTGACAGTAAGGAAGCTTCACATTGTCATTGTCATT
GCACCATTTTGGAAGATGGCTTGCATTGTTCTCGAAGAAGTTTAGCATGTAAGCATCTTTCAGCGTGAACTCTGTGACTTGAATAG
AATTAGCCAATGAGCCGAATAGGCCAGCTTCTTTGTACATTTCGAGTATGAAAGCGATGCACGAGGTTGATTTACCATCGCTGTAG
ATCCAGTCGTCTTGTTCGGGTACAGTCAGTAACTTGTCAAAAGAAGATCCACGTTTCTCTACTTCTACCAGTACATCTGAAAGACC
AAGACCCTCTGTTCCAAGCCGCTTGTTCAAGGCTTCATTCCACATATTAGCTGCATACTCAGGCTGCAATTTGTTCCAAACAGTCA
TGAAAGAAGCAACAAGATGAGCATCTATAGGAGGAGGGTAGTTTGCAGTAACGGTATCGATCCAGGCAAAAATCAAGTTGTGATAA
CCATATGGTTTATTCTCCATGCTCCGAGCATATTCCCACGCAGCAGTGACGTTGAACTTAGCACGAACATCAGGATGCAAAGGTAA
GAATGCAATCTGAGGATTCGAGTCATCTTTCTTTTGTTCAAACTCCCACCACTCCTCCCATGGTAATATCGCTATTACATCTTCTC
CCTTGTCGTTTTCATTACCGGACTCACCAATCCACAGCTTCCCTTGTGAGTCTCTCAAAAAGACAGCTGAATGACCAGCGTAAGCC
CCACTCACCCACTTCTCAAGGGTCTCAAAACCAACCCAACGTCAACGGATCTTGGATAGAACAAGTAGATCACCAGACTGGATATC
ATCAGTGTTGACTTTAGTGACCAATGGTTCAGGACGAGCTTCGAACTTAGCTCCCATATGCTTCGCAAGAAACGCGAGATTAGAGC
TCTCTCCCCAACCAGTATTGGTAAAGAGAGGAAACACATCACACAGTGCTTGTAGTGTTCCTAACATCCCTGCGTGCATAAGGAAC
ATTGAAACTCCCTTCTTCTTAACGTATTCATACTCCGCTTGTCCATCCCATTCAAGGAACTAGAATTAGGACGGCGGTGGCGAACA
GAGAGGAGAGCGTGAAAGACGATGAGGAAGATGGAGACGCCATGTCCGTTTTGCGTTCGGAGT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_200298 uncharacterized protein [Arabidopsis thaliana]18652e-206
XP_002864361 hypothetical protein ARALYDRAFT_331828 [Arabidopsis lyrata subsp. lyrata]18643e-206
XP_002867528 hypothetical protein ARALYDRAFT_913846 [Arabidopsis lyrata subsp. lyrata]18017e-199
NP_194432 uncharacterized protein [Arabidopsis thaliana]17792e-196
XP_002319305 predicted protein [Populus trichocarpa]17272e-190

Swiss-Prot top hits Scoree value
No hits found  

TrEMBL top hits (Blast detail)Scoree value
Q9FFU3 Genomic DNA, chromosome 5, P1 clone:MBG818652e-206
Q9SZ41 AT4g27020/F10M23_36017792e-196
B9I7T6 Predicted protein17272e-190
B9SAF1 Putative uncharacterized protein17031e-187
B9I0D5 Predicted protein16931e-186

Arabidopsis top hits (Blast detail)Scoree value
AT5G54870.1 unknown protein18667e-209
AT4G27020.1 unknown protein17807e-199
AT1G70160.1 unknown protein14455e-160

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
71  5%
 
114  21%
 
105  26%
 
84  21%
 
123  16%
 
92  11%

Unigene MembersMember information