Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN21522

FASTA Sequence
Unigene ID: UN21522Length: 1034  SNP
AATAGTTGGCCAATCAAAACCAAATCACATTAAATTGAAAGATGATCCATAGAAAATAAAAAAAAGGAAATAGACAATATTCAATC
AAATCCATCCATGTGTGGGCACAATGCATGTGCATACATGTTTAACCTTTTTTGCTTATTCAAAGTAAATAAAATCTTGGGTCAAC
CAAATTGTTATTTAAGCGAAGGGCCTCTGGTTTTCACAGTCCAAGTTAGGCCCAGTTCCTACATTTAACAGCCCAGCATATCTCTG
ATAAAACCCGATCCGGTCATTGACCCGCCCATCTCCAGCAATCCCGCACTCTAAACCGCCGTTTATAATGTTCGTGGTTAAACCGA
ATCCACCGGTCCGGTTAGCTGCCAAATCTGCCTCTGTAGGTCTGTATCTACCGATCATAACGTCATGGCACGAAGGTTTGGGACTC
TGCTCCGTCATCCAAAACCAAAGTGCTGTTTGGAAAGCTATCACTGAATTATTCGCCACTATCTCGGGATTCCTTAGACCGTCGAA
TCCTAAAGCTCGACCGGCCGGTCCGTAGTTATAGTTCCACGAGAGTTGAATTGGACCTCTTCCATGGTAAGTCTTGTTAGAGAAAC
AAGGCCATTCAGTATTAGAAGAATCACAATAATTGCTTTGTGGACTTATTTCTTCTTTAAAACACAACCCCCAAGCATACGGTCCG
TCCGGTGCCGTTGGCCACCCTCCAGTTGTTTCGTGTGAAATCTGAGCCAAAAACGCTGCCACCTCGCGTCTTCGTGTCTCCATGGA
TCCGATGCTTCCAAATCTTGGAAACCGCCTCGTTGCCTTCACAAAGGATTCGTAAGTGTAGAAACCATTTGCTGGACAAGCAGTAT
TTTCCTTGTGGATGAACATTGAGTCGTAAAGCGATTTTGGCACCAGACGCGCGACTGTGGTAGCCTCGGTTTGGTTGGAAAACAGT
ATTGAGAAGAATGAGAGAAAGAGGCAAAAGAGAAGAGATAAGTGTTGAGCCATTTTTAGAAGGATTTTGGTGTGTTTTTTTTGTGT
CC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
BAJ33936 unnamed protein product [Thellungiella halophila]13623e-148
XP_002892104 hypothetical protein ARALYDRAFT_887375 [Arabidopsis lyrata subsp. lyrata]12593e-136
NP_171738 putative chitinase [Arabidopsis thaliana]12583e-136
NP_192079 class II chitinase-like protein [Arabidopsis thaliana]11097e-119
XP_002872878 hypothetical protein ARALYDRAFT_912061 [Arabidopsis lyrata subsp. lyrata]11033e-118

Swiss-Prot top hits (Blast detail)Scoree value
Q5NB11 Chitinase 1010072e-108
Q09023 Endochitinase CH258673e-092
Q7DNA1 Chitinase 28575e-091
P85084 Endochitinase8494e-090
Q688M5 Chitinase 98423e-089

TrEMBL top hits (Blast detail)Scoree value
Q9FZ25 At1g0236012582e-136
Q9ZSI6 At4g0170011095e-119
B9RN36 Class I chitinase, putative10971e-117
Q9SPT8 Chitinase (Fragment)10899e-117
Q9SPT9 Chitinase10862e-116

Arabidopsis top hits (Blast detail)Scoree value
AT1G02360.1 chitinase, putative12591e-138
AT4G01700.1 chitinase, putative11102e-121
AT3G12500.1 ATHCHIB (ARABIDOPSIS THALIANA BASIC CHITINASE); chitinase8422e-090
AT3G16920.1 chitinase4758e-048
AT1G05850.1 POM1 (POM-POM1); chitinase4623e-046

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
82  7%
 
126  21%
 
65  17%
 
72  7%
 
1010  34%
 
114  14%

Unigene MembersMember information