Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN21544

FASTA Sequence
Unigene ID: UN21544Length: 1233  SNP
GGGACACAACCAAAATTCATCTTAACGAGAACACAAGTTAAGAAGAATAAAAAGAGAACCACGTTTAGTTTGTAGTATATGAGAGC
TGCTTTAAACAGAGCAAATCTTCTTGGAGGGTTGTTTTCATTCAGAAACGTTAAATCGATGTCGTCGTCGTCTTCTTCTCAAAACT
TTGTATCAAGATCTGTAATCAAGAAAGTCTTCGCTAAGCTTCAGAAAGAAGGCGATGGAGCGGTCGTTAGACGTGGCATTTCCAGG
AGTGAGCAGAAGTTATTAGATCCGTTCTTGATGCTTGATGAATTCTCCGTTTCTCCTCCAGCTGGATTCCCAGATCATCCTCACAG
AGGTTTTGAAACTGTTACATACGTCCTAGAGGGAGGAATCACTCATCAAGATTTCAAAGGCCATAAGGGCACAATATATGCTGGTG
ATGTTCAGTGGATGACTGCAGGAAGAGGAATCATTCACTCTGAAATGCCTGAAGAAGAAGTTAACAAAGGTTTACAACTTTGGATC
AATCTGTCATCTAACGAGAAAATGATAGAGCCAAACTACCAAGAACTGTCGATTTCAGACATACCAAAAGCAGAAGAAAACGGTGT
TCAAGTCAAAGTAATAGCAGGAGAATCAATGGGAGTTCAATCCCCTGTTTACACAAGAACACCAACAATGTTCCTCGATTTCACTC
TCGATCCAGGAGCTCAGTTCCACCAGAACGTTCCTGAATCTTGGAATGCGTTTGCTTACGTTCTTGAAAGCGGTGAAGGCGGAGCT
GTTTTCGGCTCACCAAACGCGTCCCCTGTTTCACCACACAATGTTTTAGTGTTCGGACAAGGAAATGACGGTGTTAGCGTGTGGAA
CAAGTCAGCTTCCAAGAAATTGCGGTTTGTGTTAATTGCTGGAGAACCAATAGGTGAGCCGGTGGTTCAGTACGGTCCGTTCGTGA
TGAATACTCAAGCTGAGATTGATATGACCATTGAAGATTATCACTATGGTAAAAATGGCTTCGAAATGGCAAAGTATTGGAGGTCA
CAATGATAGATACTAATAATAATCAATGTTTTAATTATTGTTTTCATACTTGTTTTTATCTTATGTGTGTTTTGAATGGGACAATA
ATAAAGTTTAAAACCCAGTTTCTTTTTGCTTAAGTATGTGGGTGGGAACCCATTAAATTCAAAGCTGACTTTGTTTGTAGTTCCAA
ATTCCAACCGTAGTGGTCGTTATTATGCT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002880027 predicted protein [Arabidopsis lyrata subsp. lyrata]15669e-172
NP_850385 pirin-like protein [Arabidopsis thaliana]15344e-168
ABK95380 unknown [Populus trichocarpa]11358e-122
XP_002320452 predicted protein [Populus trichocarpa]11341e-121
XP_002302888 predicted protein [Populus trichocarpa]11223e-120

Swiss-Prot top hits (Blast detail)Scoree value
Q9ZW82 Pirin-like protein At2g4312015342e-169
Q9LX49 Pirin-111041e-119
Q9SEE4 Pirin-like protein9921e-106
Q9LX45 Putative pirin-like protein At3g592609786e-105
Q9LPS9 Pirin-like protein At1g505908971e-095

TrEMBL top hits (Blast detail)Scoree value
A9PG77 Putative uncharacterized protein11356e-122
B9IAC9 Predicted protein11347e-122
B9GU87 Predicted protein11222e-120
Q147N7 At3g5922010952e-117
B9SN16 Pirin, putative10882e-116

Arabidopsis top hits (Blast detail)Scoree value
AT2G43120.1 pirin, putative15351e-170
AT3G59220.1 PRN (PIRIN); calmodulin binding11041e-120
AT3G59260.1 pirin, putative9794e-106
AT1G50590.1 pirin, putative8971e-096

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
104  10%
 
64  10%
 
1111  28%
 
1211  28%
 
78  21%
 
81  3%

Unigene MembersMember information