Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN21547

FASTA Sequence
Unigene ID: UN21547Length: 1162  SNP
AAGGAACAAATCTCTAGTACTGTCGAATTCGAACAGAAAGACAACAAAAGCTTCGGTGAGTAGAAATCAAAGAAAATGCTACATGT
CCAATGAAAAAAAACCAGTTCATATACTAGTTTCACGATAGGGTTGTAAGAATAAGATGCTCATTCTGATAGATTTATAAAAGCAG
CGACTCTAGGTGAGACAAAGAGTCCTTATGCATTGTTTTAGCAGTGAACCATGGATTTTGAGTTCTTTCAGGCGAAAGATTGAAGC
GCTCTCTCGAAGTTATCTTCAGCAGATGCTGCTCTCTTCACAAGTACATGTTCTGGATGCGACAGTTTCAGCTGGCTTAGGTAACG
TGATGATGATTGTTTCCCCACATGAATACTGCACACAACTAAGTTTGCAAGAGTTTCTGGGTCTTTCGCATCCTTGTTGAGTGCTT
CAAGCAGAAGAGTCTCAGCTTCTTCAAAGTTGCCCATATGCATGCAACAAACCGCCTTGCTGTTCAAGATCAAGCTTGTCATTGGG
TACTTCTCAGAGAAATCCTGGAAGATTAGATAAGCTTCCTGTATCTTGGAACCCCCAACTGCCAGGTTCAACCATGCACTGGCGAG
TTGAGTGAGAGTGTGGTCTTCATCAAACTGTTGCATCACTCTCAGCTGTTTCTCAGCATAATCTGACCTGTGCATCTTTATGAATA
TCTGGACATTCAAAGCATGCAGGTCCATGGTTCCTCCAGAATGAGTGTGCTTAAGAGCCTCGCTATAGTCTTCCTCATGCATGAAG
ATAGTACCAGCAATCAACCTAACAGTAGCATTGTTTCCACCAGTTGGATCTGCCAACCATTCCCTCAAGCTAGCAATGGTTGATTC
CTTATTTTCAGGGCTCGATAGATACATAGCGAGGAGCTTCACTGCTTGAAGAGGAGTAGCCGACGCTTCGTCGATCTCATTGATGA
CAAGCTGGTAGCTACCAAGAGCGATGTAAGCGCGGTGGACGAGGCAATCGCGCTCGATGATATCTTCCTGCGAAAGATTAGGGATC
TCGCTGTTGTTGATCGCCGCTTGATACGCACCTAGGTAAAAACTGTTTCTCAGATTAAAGAGGTGATCTGGTCCTGCCGCCATGGA
TGCCATTCTGCTCGTCTTCTTCCTCTAGATCTCACAGATCTCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_174351 coatomer subunit epsilon-1 [Arabidopsis thaliana]14011e-152
AAM65018 coatomer-like protein, epsilon subunit [Arabidopsis thaliana]14001e-152
XP_002893638 coatomer protein epsilon subunit family protein [Arabidopsis lyrata subsp. lyrata]13912e-151
NP_181030 coatomer subunit epsilon-2 [Arabidopsis thaliana]12872e-139
XP_002317073 predicted protein [Populus trichocarpa]12782e-138

Swiss-Prot top hits (Blast detail)Scoree value
Q9SA78 Coatomer subunit epsilon-114052e-154
O64748 Coatomer subunit epsilon-212886e-141
Q9MAX6 Coatomer subunit epsilon-111632e-126
P0C541 Coatomer subunit epsilon-29794e-105
A2XY73 Coatomer subunit epsilon-29751e-104

TrEMBL top hits (Blast detail)Scoree value
B9I0V9 Predicted protein12781e-138
B9SV80 Coatomer epsilon subunit, putative12199e-132
Q9MAX8 Epsilon1-COP11777e-127
C6TGT0 Putative uncharacterized protein11633e-125
Q9MAX7 Epsilon2-COP (Fragment)11615e-125

Arabidopsis top hits (Blast detail)Scoree value
AT1G30630.1 coatomer protein epsilon subunit family protein / COPE family protein14061e-155
AT2G34840.1 coatomer protein epsilon subunit family protein / COPE family protein12894e-142
AT2G34840.2 coatomer protein epsilon subunit family protein / COPE family protein9581e-103

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
116  19%
 
67  23%
 
89  29%
 
96  19%
 
122  6%
 
71  3%

Unigene MembersMember information