Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN21560

FASTA Sequence
Unigene ID: UN21560Length: 1046  SNP
GGACGTAATCCGAAATTTCTTCTTTCTTTTCGTCGTAAGAGATTACAAGTTTCTTTGTTTTATTAATAAGAAGAACGCAACTTTTC
TATTGAATATTATTGGATTATTTCATAAGTTAAGGAGAAATAAGTTGTTCAAAAAAAAAAAAAAGGAGAAAAATAAGAAGGCTTCT
CCTTCTCCTATAAAACAACCCTTCACGTCAAACTAGCTCAGCGACACTATACGTATCAACCAATGGGTCGTGTTACTACTCCACAA
AGGGAGAATCCAGATGACAGTTCACCAGTTCAGCAAACCGGTATACCGGTCCAACAAACCGGAGTTCCCATGAGCCAGTTTGCACC
GCCTAGTTATCATCAAGCTAATGTTAACATATCGGTTGGGACTCCATGGAGGAGTGGTTTGTTTGATTGTCAAGAAGACCAAACCA
ATGCCGTGATGACAGCAATCTTACCATGTTTGACATTTGGACAAATAGCTGAGGTGTTGGATGAAGGCGAGATGACTTGTCCTCTT
GGAAGTTTCATATACTTGTTGATGATGCCGGCTTTGTGCTCACAGTGGGTGATGGGATCAAAGTATAGGGAAAAAATGAGGAGAAG
ATTTAATCTTGTGGAAGCTCCATATTCAGATTGTGCCACTCATGTCTTATGCTCTTGTTGCTCTCTTTGTCAAGAATATAGAGAGC
TCAAGGCTAGGAATCTTGATCCTTCTTTGGGTTGGAATGGGATACTTGCTCAAAGGCAAGGACAACATGAGAGTGACGCACCAAGC
TTTGCTCCACCAAAGCAATATATGTCTAAGTAAAGATTTATATCGTAGTTAACCTCCAAATTTTATATACATTATTTGCGACCATC
ATACAATGCCAGTGTGGTATATGTATTATATAATGTAAAACAAAAGACATCCACATCTTCAAGTTTTTGGACTTTGTTGTTTTCGT
TTTTTCTTTATGTAACTAAATTGGTTTGATTTATTTTTCAGTTGTTGGTTATTGTGAAAGTGTTATTTGTTGAAGTAACTAAATTG
GTTTTTGTTTTGTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002894363 hypothetical protein ARALYDRAFT_892219 [Arabidopsis lyrata subsp. lyrata]8444e-088
AAM62872 unknown [Arabidopsis thaliana]8418e-088
NP_564602 PLAC8 family protein [Arabidopsis thaliana]8363e-087
CAN75403 hypothetical protein VITISV_010506 [Vitis vinifera]5594e-055
ABD32291 Uncharacterized Cys-rich domain [Medicago truncatula]5577e-055

Swiss-Prot top hits (Blast detail)Scoree value
Q9LQU4 Uncharacterized protein At1g148702544e-021

TrEMBL top hits (Blast detail)Scoree value
Q8LE32 Putative uncharacterized protein8415e-088
Q9M815 At1g522008362e-087
A5C8F0 Putative uncharacterized protein5593e-055
Q2HU50 Uncharacterized Cys-rich domain5575e-055
C6TFF7 Putative uncharacterized protein5451e-053

Arabidopsis top hits (Blast detail)Scoree value
AT1G52200.1 unknown protein8379e-090
AT1G49030.1 unknown protein3144e-029
AT3G18470.1 unknown protein3127e-029
AT3G18460.1 unknown protein3011e-027
AT3G18450.1 unknown protein2867e-026

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
64  14%
 
118  29%
 
127  25%
 
71  4%
 
82  7%
 
92  7%
 
204  14%

Unigene MembersMember information