Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN21806

FASTA Sequence
Unigene ID: UN21806Length: 930  SNP
CTTTTCCTCACCGGAGCTTCTCTGAAGAAGTCTCTGTTCTTGATGGTCACTTTACTCAGCTGGGTTTGAACAGCGTTGCCTACTTG
ATGGGAAATGATGACGAGACTAAGAAATGGCATGTCTATGCTGCCTCTGCCCAGTCCTCCAGCAACTGCACCAACAATGTCTACAC
GCTCGAGATGTGCATGACTGGTCTTGACAGGGAGAAAGCATCTGTCTTCTACAAGAATGGCGAGACTGGATCAATGACTGACAACT
CTGGAATCAGAAAGATCCTTCCTCATTCCCAGATCTGCGACTTTGAGTTCGAGCCCTGTGGCTACTCTATGAACTCCATTGAAGGA
GATGCGATCTCCACTATCCATGTGACCCCTGAGGATGGGTTTAGCTACGCTAGCTTTGAAGCTGTGGGTTATGACTTCAACACTTT
GGACCTGAGCCAGCTGGTGACAAGGGTTCTGTCCTGCTTTGAGCCAAAGCAATTCTCTGTGGCTGTGCACTCTAGCGTTGGAGTGA
ACGCGTACAAGCCTGAGATCAGTGTGGACTTGGAAGATTACGGGTGCAGGGAGAGGACATTTGAGTGTCTAGGAGAGGAGAGTGGA
ACGGTGATGTATCAGACGTTTGAGAAGCTAGGCAAGTACTGTGGGTCGCCTAGATCTACGTTGAAGTGTGAGTGGAGCAGCAACAA
TAGTAGCTGCAGCAGCGAGGACGAGAAGGACGAGGGAATCTAGCAGAACTTTATTATCTAAAACTACTTTTGAGCTTCTTTTTTTT
TTTTGCTTTGTTTTATTTAATAATGAATAAATACTTGTGAAGCTGAGGTACTCTCCTTCATAAGAATGTGTGTTGTGTTTTCTTAA
TTTATATGAATTCTGGTTTTAATATATAAGACTGTTATGTTTGCTCTTATGATCTATGCCTTTTTATATT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002882231 S-adenosylmethionine decarboxylase [Arabidopsis lyrata subsp. lyrata]12063e-130
BAJ33801 unnamed protein product [Thellungiella halophila]12029e-130
AAS45435 S-adenosylmethionine decarboxylase [Brassica juncea]11948e-129
NP_186896 S-adenosylmethionine decarboxylase 1 beta chain [Arabidopsis thaliana]11866e-128
CAA69073 S-adenosylmethionine decarboxylase [Arabidopsis thaliana]11866e-128

Swiss-Prot top hits (Blast detail)Scoree value
Q9SDM8 S-adenosylmethionine decarboxylase proenzyme 312061e-131
Q96286 S-adenosylmethionine decarboxylase proenzyme 112033e-131
Q9S7T9 S-adenosylmethionine decarboxylase proenzyme 210232e-110
O49972 S-adenosylmethionine decarboxylase proenzyme 210152e-109
Q42613 S-adenosylmethionine decarboxylase proenzyme 18565e-091

TrEMBL top hits (Blast detail)Scoree value
Q6QJ69 S-adenosylmethionine decarboxylase11945e-129
B9DFT1 AT3G02470 protein11864e-128
Q940Q5 AT3g02470/F16B3_1011812e-127
Q6SZS4 S-adenosyl-L-methionine decarboxylase10153e-108
D6PPT9 AT3G02470-like protein (Fragment)8146e-085

Arabidopsis top hits (Blast detail)Scoree value
AT3G02470.1 SAMDC (S-ADENOSYLMETHIONINE DECARBOXYLASE); adenosylmethionine decarboxylase12042e-132
AT3G02470.3 SAMDC (S-ADENOSYLMETHIONINE DECARBOXYLASE); adenosylmethionine decarboxylase12042e-132
AT3G02470.4 SAMDC (S-ADENOSYLMETHIONINE DECARBOXYLASE); adenosylmethionine decarboxylase12042e-132
AT5G15950.1 adenosylmethionine decarboxylase family protein10312e-112
AT5G15950.2 adenosylmethionine decarboxylase family protein10312e-112

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
201  7%
 
73  20%
 
113  20%
 
183  20%
 
61  7%
 
91  7%
 
212  13%
 
101  7%

Unigene MembersMember information