Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN21820

FASTA Sequence
Unigene ID: UN21820Length: 1255  SNP
CAGTCCTAATCCAACATTTCATGCATATACTATTAGGGTTAACATAGAGTTAGGGTTGAAGTAGGGTTGAGTTTATATTTTATAGG
GTTGGCTGAGTTCGAAAACCTATATGGGATCATGGTTAGGGCTACATGTATATTTATATTAGAGATGTTTCCTAAACTATATAGAT
ACAAATATATGCGAATAGATTATACAATAAATATCCAATATTAACAATGATATTTACGATCTCCTAGATTCTTCTATAGAACATAG
GATCATATGCGATCAAAGCCGACGTCCAAATCGTCTTTCCCTGCACTGGTACGAAACCAGGGCCTCTAGCAACTTGTCTTCATTAA
AATCAGGCCAAAGGACCGGTGAGAAGAAGAGCTCCGTATAAGCGAGCTGCCACAAGAAGAAGTTACTAATCCTCTGTTCTCCACTT
GTCCTAATCAATAGATCGGGACTTGGGAACTCAGCACACTTTGTCACAAGCTCTCCCTCGAAAAGCGTCTCGTCCACGTCTTCCTC
ACTGATCAAACCTTGTTGTGATTTCTTCATAAGATTCTTGCAGGCTTGCAAGATGTCGAATCTCCCGCTGTAATCTATGGCCAAGA
TGAGATGCTTCTTCTTGTAGCTCTTCGTAGATTCCTTTAGCTCTTTAATTGTCTTGAGGAGAGATTCCGGGATCTTTTCAAGATTC
CCAATAACAGAAACTCGGATCTCCTCTCTTTTGAAATATTGTAACTTTGAGCTGAGGTATCTTTCGAACAAAAACATCAAGCAATT
AACTTCGACCTTTTGTCTTCCCCAATTCTCAGTGGAGAAAGCAAAAGCTGACACTGTTTCTATCCCTAGTTTGAAGCAGAGATCAG
CGAACTCTAAAAGCCGTTTGGCTCCTGCCTCGTGGCCTTGTAACGTCAGCAATCCGCCCCGTTCGGCCCATCTCCTGTTTCCGTCC
ATTATCACTGCCACGTGTCTCGGCATCAGCTCTCTCACAAGCCCTGAAGTTGTCCCCTCCTCTCCCACGTTCACATAAGTTCCCTC
GTCACGTTTCTCGTTCCTCTCTTCCTCATCATCGTGCCGAGAAGTTATGAGCTTAATGAATCCGAGGATATTTTTGAAGGAGATAG
GCACACTTAGACGCCAAGAGATGAAGAGCCCAGGGATGAGAATAAGAGCAAGACCAGTAAAAACAACAGAGAACAATGACACCATT
TTCTTTTTTTTTGGGTAGAAATTGTTGTCTTTATTTTCAATATTATCTCCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_568882 dehydrodolichyl diphosphate synthase 3 [Arabidopsis thaliana]11081e-118
NP_568883 dehydrodolichyl diphosphate synthase 4 [Arabidopsis thaliana]10758e-115
AAM67372 undecaprenyl pyrophosphate synthetase-like [Arabidopsis thaliana]10712e-114
XP_002866291 hypothetical protein ARALYDRAFT_496003 [Arabidopsis lyrata subsp. lyrata]10524e-112
NP_568884 dehydrodolichyl diphosphate synthase 5 [Arabidopsis thaliana]9762e-103

Swiss-Prot top hits (Blast detail)Scoree value
Q8RX73 Dehydrodolichyl diphosphate synthase 311085e-120
Q8GY03 Dehydrodolichyl diphosphate synthase 410753e-116
Q570Q8 Dehydrodolichyl diphosphate synthase 59761e-104
O80458 Dehydrodolichyl diphosphate synthase 19599e-103
Q56Y11 Dehydrodolichyl diphosphate synthase 26839e-071

TrEMBL top hits (Blast detail)Scoree value
B9SI16 Undecaprenyl pyrophosphate synthetase, putative7305e-075
A5BX88 Putative uncharacterized protein7101e-072
B9GGB3 Predicted protein (Fragment)6902e-070
B9GII5 Predicted protein (Fragment)6893e-070
B9HP45 Predicted protein6893e-070

Arabidopsis top hits (Blast detail)Scoree value
AT5G58780.1 dehydrodolichyl diphosphate synthase, putative / DEDOL-PP synthase, putative11211e-122
AT5G58782.1 dehydrodolichyl diphosphate synthase, putative / DEDOL-PP synthase, putative10762e-117
AT5G58784.1 dehydrodolichyl diphosphate synthase10091e-109
AT2G23410.1 ACPT (Arabidopsis cis-prenyltransferase); dehydrodolichyl diphosphate synthase9606e-104
AT5G58770.1 dehydrodolichyl diphosphate synthase, putative / DEDOL-PP synthase, putative6838e-072

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
94  25%
 
73  19%
 
82  13%
 
114  25%
 
62  13%
 
101  6%

Unigene MembersMember information