Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN21850

FASTA Sequence
Unigene ID: UN21850Length: 1287  SNP
GGAGATCTCAAAGAGTTATTGGAGTTTGAGAAAAACTTTGTTCGTGCTCTGTTCTGTTCGTATGTACTTTCGTGGTTGGGGGTAAT
TAAAGTCAAACACACGAAATAATAATAGTTCGCACAAAATCCCCGGAGAAATCTGCACCGGAACCACCACCGGGAATCATGGGAAT
CACGGGAAGTCTAACACCAGATCAGCTCGAGTTTTACAACTCTCAAGGTTATTTGGTGATCGAATCTTTCGCGAGTGAGGATGAGA
TTGGCGGCTTGAGGAAGAGGATGGATGAGTTGTTGACTCAATTTGATTGCTCTGTCTCTTCTATTTTCTCCACTAAAAACCAGAAG
AACACGACCGATAATTACTTCTTTGAGAGCGCTGAAAAAATCTCCTTCTTTTTTGAAGAAAAAGCTTTTGGCGACAATGGGGAACT
GAAGCAACCGAAAGAGCTTTCTATAAACAAAGTTGGCCACGCACTGCACGAGCTTGACCCTTTGTACAAGGAGTTCACGTATTCGT
CCAAGGTTTCAAGTTTGGTATCATCCTTAGGTTACAGAAGACCAGTCGTCATGCAGGCCATGTACATTTTCAAGCAACCTGGAATT
GGAGGAGAAGTTGTGCCACACCAAGATAATTCTTTTGTCTACACGGACCCACCTAGTTGTACTGGTCTCTGGATGGCTTTAGAAGA
TTCCACAACTGTTAACGGTTGTCTTTGGGCCATACCTGGATCTCACAAGAACGGTCTGGTTAGAAGGTTTATCCGGGGTGAAAATG
GTGTAACGTTTGATAGGCCATCACCGTCTTACGACCAGAAAGATTTTGTGTCTATTGAAATGAAAGCAGGCTCATTGATCGCCATT
CATGGTGATCTAATCCATCAAAGTTTCGAGAATCTATCTGCCAAGTCAAGACATGCATATAGCTTACATGTGGTAGAATCTGATGG
ATGCAAATGGGCACCAGACAACTGGATTCAAAGAGAAAAAATGCCTGAGCCTCTCTATGCCCCTTGATACAAGCCAGTCTGCGTTT
ATCAAATTTCTTCTACCCGCGACCATTTGTTGTTAGTACTCTGAACATGGCTAAAGAGGCCCTTCTTTTGTCGTTTACTTGTCGAA
ATACAATTTGTTTCTGCTTGGTCTCTTTAGATAATGGTCAATAAAGTATGGCAGTGCTTATTAATGTTTCTGTGGTTATAGGTTTG
ATTGAATTCACAGTAATTAGACATTGAAGAACATTTGAGGAATCAATGAACATTGGATATATCTTTTTAAAGAAAATATTGTC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
XP_002875075 hypothetical protein ARALYDRAFT_484067 [Arabidopsis lyrata subsp. lyrata]13859e-151
NP_565262 phytanoyl-CoA dioxygenase (PhyH)-like protein [Arabidopsis thaliana]13813e-150
AAM65626 unknown [Arabidopsis thaliana]13786e-150
XP_002309477 predicted protein [Populus trichocarpa]11644e-125
XP_002284469 PREDICTED: hypothetical protein [Vitis vinifera]11393e-122

Swiss-Prot top hits (Blast detail)Scoree value
Q0IIB1 Phytanoyl-CoA dioxygenase domain-containing protein 16434e-066
Q5U3U0 Phytanoyl-CoA dioxygenase domain-containing protein 16391e-065
Q5SRE7 Phytanoyl-CoA dioxygenase domain-containing protein 16363e-065
Q5BJP9 Phytanoyl-CoA dioxygenase domain-containing protein 16239e-064
Q9DB26 Phytanoyl-CoA dioxygenase domain-containing protein 16174e-063

TrEMBL top hits (Blast detail)Scoree value
Q9ZVF6 At2g01490/F2I9.1113812e-150
Q8LA19 Putative uncharacterized protein13784e-150
A9PET6 Predicted protein11643e-125
C6TGT7 Putative uncharacterized protein11312e-121
B9SJ62 Phytanoyl-CoA dioxygenase domain containing, putative11114e-119

Arabidopsis top hits (Blast detail)Scoree value
AT2G01490.1 phytanoyl-CoA dioxygenase (PhyH) family protein13811e-152

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
61  8%
 
94  31%
 
123  23%
 
202  15%
 
101  8%
 
112  15%

Unigene MembersMember information