Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN21852

FASTA Sequence
Unigene ID: UN21852Length: 1413 SSRSNP
GGATTCACACATTTTCCCTTTCACTTATTAGCCAGAGAGAGAGAGAGAGAGAGAAAGATAATGCCAATCAGTCGGAGAGTTCTGAC
GCCTGTCGCGGCCGCTCCGGTTATCTTAGCCGTCGTTTGCTATTTATTCTGGTCAACTATCATCGAGCCGGACCGTTTAGAGGGTA
CGAAACACGTTCTTCAAGTGGCTAAGACCATTCCTCTCCCCGGCGTTGGACCAGAGAGCTTAGAGTTTGATTCACAAGGTGAAGGC
CCTTATGTCGGTGTCACCGACGGTCGCATCCTCAAATGGCGTGGCGAAGAACATGGCTGGGTCGACTTCGCCTACACTTCTCCTCA
CAGAGATAACTGTTCGAGGAATCAAGTAGTACCAAGTTGTGGAAGACCCTTGGGACTTAGCTTCCACAGGAAAACAGGAGACTTGT
ACATTTGTGATGGTTACTTTGGGGTCATGAAGGTCGGACCAGAAGGAGGCTTGGCCGAGTTAGTCGTTGATGAAGCCGAAGGCCGC
AAAGTTATGTTTGCGAACCAAATGGACATAGACGAAGAGGAAGACGTCTTCTATTTCAATGATAGCAGCGACAAATACCATTTCGG
GGAAGTGTTCTACGTGTCTATATCCGGGGACAAAGTGGGAAGAGTAATTAGATACGATATGAAGAAGAAAGAGGCCAAAGTTATAA
TGGACAAACTTCATTTACCTAATGGTTTAGCTCTAAGCAAAGACGGATCTTTTGTAATCACCTGTGAAGGTGGTACGGGTATTCTC
CACAGAATATGGGTCAAAGGTCCTAAGGCCGGGACCACCGAGGTTTTCGCCAAGGTCCCTGGCCCTCCGGACAATATCCGACGTAC
CCCTACTGGTGATTTTTGGGTCGCGTTGCACTGCAAGAGCAATTTGTTCACTAGGTTGTTTCTGATTCACTCTTGGGTTGGAAAGT
TTTTCATGCATACATTGAAGTTGGAGACAGTGGTTCATCTCATGAACGGAGGGAAGCCTCATGGAATAATCTTGAAACTCTCTGGA
GAGACCGGAGAGATTATTGAGATGCTTGAGGATAGTGAAGGGACAACGATGAAGTATGTTAGTGAAGCTTATGAGAGGGAAGATGG
GAAGTTATGGATCGGGTCTGTGTATTGGCCAGCCGTTTGGGTTCTTGATAAATCTGTTTATGAGGGCAACAAATGAGTGACCAAAC
GCAAAATGAATAAAATGTTCGTGGCGTGGTTTGTTTACTAGCGGAATGCATTTTGTTTCGTATCTTTTGTTTTTGTTTGTTTCTGT
TGTTATTGTTGTGTGAGTGGACTTTGTTGGTATTGTTGTTATTGTTGTGTGTGTGGAATTTGGATCTTGTTTTCTGCAAAGACGAG
CCAATCTAAAAAGGAAAGAAAAAAGAACAATTTAGCT

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_191260 strictosidine synthase family protein [Arabidopsis thaliana]17407e-192
AAK43996 unknown protein [Arabidopsis thaliana]17362e-191
XP_002878125 strictosidine synthase family protein [Arabidopsis lyrata subsp. lyrata]17102e-188
CAB69786 hypothetical protein [Arabidopsis thaliana]16162e-177
NP_191261 strictosidine synthase family protein [Arabidopsis thaliana]14281e-155

Swiss-Prot top hits (Blast detail)Scoree value
P92976 Strictosidine synthase 34132e-039
P68174 Strictosidine synthase (Fragment)4114e-039
P68175 Strictosidine synthase4114e-039
P94111 Strictosidine synthase 14088e-039
P18417 Strictosidine synthase3801e-035

TrEMBL top hits (Blast detail)Scoree value
Q9M1J7 Putative uncharacterized protein At3g5701017405e-192
Q94K89 Putative uncharacterized protein At3g5701017361e-191
Q9M456 Putative uncharacterized protein (Fragment)16161e-177
Q9M1J6 AT3g57020/F24I3_10014287e-156
Q9ZVB7 Putative strictosidine synthase12055e-130

Arabidopsis top hits (Blast detail)Scoree value
AT3G57010.1 strictosidine synthase family protein17403e-194
AT3G57020.1 strictosidine synthase family protein14284e-158
AT2G41300.1 strictosidine synthase12171e-133
AT3G57020.2 strictosidine synthase family protein10692e-116
AT3G57030.1 strictosidine synthase family protein8657e-093

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
94  12%
 
66  18%
 
1114  42%
 
105  15%
 
72  6%
 
121  3%
 
201  3%

Unigene MembersMember information