Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN21923

FASTA Sequence
Unigene ID: UN21923Length: 952  SNP
GGATGCTCCAATCTCTCTCTCTTCTCTTCTTCCTCTTTGCTAACAAAGCATCATCCTTTTTTGCTGAAGACGGAGAAGCTCCATGA
CGAAGCAGCACGCGAACTGGTCTCCTTACGATAACAACGGAGGAACATGTGTGGCCATAGCTGGATCGGATTACTGCGTTATCGCC
GCCGATACTCGGATGTCTACCGGTTACAGTATTCTCACTCGCGATTACTCCAAAATCCATAAACTAGCAGACAAAGCTGTGCTCTC
TTCCTCTGGCTTTCAGGCTGATGTGAAAGCGTTGCAGAAAGTTTTGAAATCAAGGCACTTGGTTTATCAGCATCAGCATAACAAGC
AGATGAGCTGTCCTGCGATGGCTCAGCTTCTCTCCAACACGCTTTACTTCAAGCGCTTTTTTCCTTACTATGCATTTAATGTTCTA
GGAGGGCTTGACGAGGAAGGTAAAGGTTGCGTCTTTACTTATGATGCTGTTGGTTCGTATGAGAAGGTTGGATACAGTGCTCAAGG
TTCTGGTTCCACTCTAATCATGCCTTTCCTTGACAATCAACTCAAGAGTCCCAGCCCACTTCTGCTCCCTGCACAGGATGCTATCA
CACCCCTTTCCGAACTTGAAGCAGTTGACTTGGTCAAGACTGTTTTCGCATCTGCCACTGAGAGGGATATCTACACTGGAGACAAG
CTTGAGATCATGATTCTCAAGGCCGATGGCATCAGGACCGAAGTCATGGACTTGAGGAAAGACTAAGCAGAGCATATGAATGTTGT
GAACACTCTCACCTTCGTCCGTTTTTTTCTTATTCGCATCTCAACATTAGTTCCCCTTGGTTATCTTGTACTGTATTATTGGCTTA
ATGTATTACAGTAATCAACTCATGCTTGAAGTTTCCTTTATGACAAAGTTCTTTTGGAGAGTTTTAATAACAATATTCGATTTCTT
AGCTAC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
CAA47753 proteosome subunit [Arabidopsis thaliana]11185e-120
NP_191641 proteasome subunit beta type-1 [Arabidopsis thaliana]11113e-119
NP_001030905 proteasome subunit beta type-1 [Arabidopsis thaliana]10971e-117
ACU14187 unknown [Glycine max]10479e-112
O82531 RecName: Full=Proteasome subunit beta type-1; AltName: Full=20S proteasome alpha subunit F; AltName: Full=20S proteasome subunit beta-610406e-111

Swiss-Prot top hits (Blast detail)Scoree value
P42742 Proteasome subunit beta type-111111e-120
O82531 Proteasome subunit beta type-110403e-112
O64464 Proteasome subunit beta type-19077e-097
Q9IB84 Proteasome subunit beta type-1-A5511e-055
Q9IB83 Proteasome subunit beta type-1-B5511e-055

TrEMBL top hits (Blast detail)Scoree value
Q2V3M5 Proteasome subunit beta type10971e-117
C6SY64 Proteasome subunit beta type10476e-112
B9RDD5 Proteasome subunit beta type10387e-111
C6TFJ3 Proteasome subunit beta type9912e-105
A9PD57 Proteasome subunit beta type9813e-104

Arabidopsis top hits (Blast detail)Scoree value
AT3G60820.1 PBF1; peptidase/ threonine-type endopeptidase11121e-121
AT3G60820.2 PBF1; peptidase/ threonine-type endopeptidase10984e-120
AT3G27430.1 PBB1; endopeptidase/ peptidase/ threonine-type endopeptidase1253e-007
AT3G27430.2 PBB1; endopeptidase/ peptidase/ threonine-type endopeptidase1253e-007
AT5G40580.1 PBB2; endopeptidase/ peptidase/ threonine-type endopeptidase1244e-007

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
77  37%
 
102  11%
 
82  11%
 
93  16%
 
121  5%
 
112  11%
 
62  11%

Unigene MembersMember information