Library    |     Search    |     Batch query    |     SNP    |     SSR  

Information for unigene UN21972

FASTA Sequence
Unigene ID: UN21972Length: 1347  SNP
ATTCCAAAGTATAAATTTTATTATATTGGAGGGGCCAACTTATAAAAAACACGAAAAAACCATGTCCATATATAACAGTACCTTAC
AGAACACGCGACCCAGAGTTTTGTGAAACCCAACACGGAAGGTAAACAGATTCAATAAAGAAAGGGAATGGAATTTAAAGACGAAA
CCATCACTTCACATTAACATTAAATACGAACTTCGGTTTTCTTCTTTTAAGTCGCCGGTTTCGAGGAATCTCCGGCGTCAAGTTTC
ACGGCGGAATTTTCGTGGCGCAAGCTATTTTCCCTAGAGTATGGTTTCTTAGAACCCTGGAAAATGTTTCCGAGCTTCCTCAACCC
TCTTGCTCTAGTTCGAAGAACATCTTTTGAAACACTCGGATCTTTAAGCACCGCTTGGCAGACACGAGATAAGGTTGATTCGATGT
CAAGCACGTTGATTTGCCAAAGTGACTGAAGCATTGCATCTTTTTTAGCTTCAATCGCCTTCTGAATATGCTCCTCTTTGTTCTCT
CCCTGGTTCAGCTTGCTCACTTCGTCCTGCAACACCAGTAACGAAACCGCACCAGAAGCAGCCATGACTTGAGATTTGATGAGGTG
GCCTTTGTCACGCACCCATTCAGCTAAGAAGGGTACTTTCATGAGACGTTTGTCCTTCCCGAGTTCTTTCGCAGCTTTTCTAGTGT
AGATGTAACCCACAGTGTGCAGCATTGCTTCCCCAAAACCAGCAGTTGAGAGTCGCCTTGCCTCAGCGGTAGCCCAATTCACAAAA
TCATCGGTTCGTCCTTCCACGAATGGTTCGAGTTTGTTCTTCAGTGTAGTGACAAGCTTGTCTTCCCTTTCCTTTTGCATCGCTTT
GATCTTGTCTTGAAGCAACTTTTTCCTAATCTCAGGCTCATGGGATTCTACTTCAGCGTCGAGGGATGCAATGGAAGCGAGAGCAA
GTTGGCCAATATAGTCCTCAAACAACTCGCTGCCAAAGAGCATTCCAAACACAGCTGCAGGATCAACCATTGCATCCTGTTGAACG
CCGTCTTTGCCAAATTTATCATAAGCAGTTCGCTTCTCGGGATCGCTAAGAACCTGGTAAGCTTCACCTAGTGTCTGAAAGTTTTT
AGCAGCTTGAGGATCATTAGGGTTCTTGTCTGGATGAACTTGCCTTGCTTTGATATAATAAGCTTTCTTAATGTCAGCAGCTGAGG
CATCAGTCTTGACACCTAAGACGTCGTAATATTCACTCTCCTTCACCATTCCCTCCTCTCTCTCTATAAAGTGTTCGTGGAGCACA
AAAGCCAGAAAGAGATTGGATTGATCTGCAAATAGATTTTTAGATTTGGTAAGTGCC

Annotation (GO term)
GenBank top hits (Blast detail)Scoree value
NP_195626 DNAJ heat shock N-terminal domain-containing protein [Arabidopsis thaliana]15533e-170
NP_179746 DNAJ heat shock N-terminal domain-containing protein [Arabidopsis thaliana]14476e-158
XP_002880388 DNAJ heat shock N-terminal domain-containing protein [Arabidopsis lyrata subsp. lyrata]14422e-157
XP_002868890 DNAJ heat shock N-terminal domain-containing protein [Arabidopsis lyrata subsp. lyrata]13876e-151
XP_002512946 Chaperone protein dnaJ, putative [Ricinus communis]12999e-141

Swiss-Prot top hits (Blast detail)Scoree value
Q8GYX8 Chaperone protein dnaJ 109365e-100
P39101 Protein CAJ13012e-026
P40564 DnaJ-like protein 12941e-025
Q2S030 Chaperone protein dnaJ2402e-019
A6W2D1 Chaperone protein dnaJ2295e-018

TrEMBL top hits (Blast detail)Scoree value
Q9T024 AT4g39150/T22F8_5015532e-170
Q9SJS8 Putative DnaJ protein14474e-158
B9RH87 Chaperone protein dnaJ, putative12996e-141
B9HRK0 Predicted protein12404e-134
C6TI60 Putative uncharacterized protein12404e-134

Arabidopsis top hits (Blast detail)Scoree value
AT4G39150.1 DNAJ heat shock N-terminal domain-containing protein15549e-173
AT2G21510.1 DNAJ heat shock N-terminal domain-containing protein14482e-160
AT1G76700.1 DNAJ heat shock N-terminal domain-containing protein9364e-101
AT1G21080.1 DNAJ heat shock N-terminal domain-containing protein9024e-097
AT1G77020.1 DNAJ heat shock N-terminal domain-containing protein8442e-090

EST library breakdown for ESTs in the assembly
Library ESTsPercentage of ESTs in assembly
 
96  21%
 
79  31%
 
85  17%
 
113  10%
 
202  7%
 
182  7%
 
211  3%
 
101  3%

Unigene MembersMember information